SimpleSearch - Line and FST details


Line specific information

 
Line ID 422C06
Vector Used pAC161
Line Availability only available from NASC (N440446)
Segregation Analysis 50:47:45
Confirmed for Hit At2g14760
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g14760

 
Sequence (A. th genome BLAST matches underlined)
>43-K017808-022-422-C06-8409
TATATGGTTCACCGTGTACTATCGTGTACCTCTCCTATAGTGAGATTGGTCCTATGGGAT
CCTCCTCTATAGTGAGAGAGAAAGCTTTGTCTTTCTCTATATCTGTTATAGCATGAGTTA
AAATCTGTATTTAGTCATTGGTAATTCAATACAAAAAGAAGAGGATCAGACCTATACAAA
TCCTTGGAGGGGAGATAAATCCAGGTTCAACTGTATCTATTATGTTAATAATATAGAGTT
GTGAAGAAAATAATGAATGTAAGGAAAAGGTACAACTATGGGATCCTCCCTTATAGTGAG
GenBank Accession BX288984 [GenBank]
Graphic View Graphic view of gene At2g14760
Predicted Position of Insertion Chr2:6323412 - go to primer design
BLAST e Value 2e-104
Hit Clone Code (BAC ID) F26C24
Hit Gene Code At2g14760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g19150

 
Sequence (A. th genome BLAST matches underlined)
>43-K017846-022-422-C06-8409
TTTCCCGGGAGCTGCATGTGTCATACTCATTGCTGATCCATGTAGGCGGAAAAATCGCCT
TTTTTCTCTTTTATATCAGTCACTTACATGTGTGACCGGTTCCCAATGTACGGCTTTGGG
TTCCCAATGTACGGGTTCCGGTTCCCAATGTACGGCTTTGGGTTCCCAATGTACGTGCTA
TCCACAGGAAAGAGACCTTTTCGACCTTTTTCCCCTGCTATGGGATCCTCCCCTATAGTG
AGGANANANANACNNNNANNGANCTCTNNNTGTNNCAATTNTGACAGGCACAANCCGCGA
CAAAATAAGAAGATGAAGAGGAGGAGCATCGGCTGATCTTCACTCCGCGGCAAGATCCGG
AGATTTAGCAGCAGATCAATCTATTATCATCTCTAATCCTTTGGCTGGTAATTCTA
GenBank Accession FR809994 [GenBank]
Graphic View Graphic view of gene At4g19150
Predicted Position of Insertion Chr4:10472909 - go to primer design
BLAST e Value 2e-39
Hit Clone Code (BAC ID) T18B16
Hit Gene Code At4g19150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03