Sequences from confirmation amplicon


Confirmation sequences for line 430F02 and hit At1g28560 are shown.
Line ID 430F02
Locus At1g28560 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10039785
Primers used for PCR MO01 - 8474, show primer details
   
Sequence Name 27-K023835-022-430-F02C-8409
GenBank Accession LN498209 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K023835-022-430-F02C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGGTAATTTTTCTGTCATCTTCATTACC
TCAGTATTCTTTAGTGTCCTCTTCTTTACCTCGGTATTCTTTACTGTCCTCTTCCTTTTT
GCCCTCCCAGCTAATGGATTTTCACTGCAGCATACCGAGAAGGTAACTGTTTGTTATCGT
TCTACAATTGTCTACGTCAACCATACTTTGTCTCTGGAAGATTTCTAATCATGACTAAGC
TATTAACATATATATTGTCTACAAGACTTTCGAAATATATTGGGAGCTAGCACGGCTGCA
CGGCTGAACCAGAACCAATTGAGACTGTAAACAAAAAACTTAACAACCATCGAAGCACAC
TAATAGAAAGAAGCTACATGCCAATTCGTTTTTACTAAGGATTCACACAAGGGGAAA
   
Sequence Name 31-K023835-022-430-F02C-MO01
GenBank Accession LN499992 [GenBank]
Sequencing primer gene specific primer, MO01: 5'-TGATATAATGTTTCCCCTTGTGTG-3'
Sequence (A. th genome BLAST matches underlined)
>31-K023835-022-430-F02C-mo1
CTTAGTAAAAACGAATTGGCATGTAGCTTCTTTCTATTAGTGTGCTTCGATGGTTGTTAA
GTTTTTTGTTTACAGTCTCAATTGGTTCTGGTTCAGCCGTGCAGCCGTGCTAGCTCCCAA
TATATTTCGAAAGTCTTGTAGACAATATATATGTTAATAGCTTAGTCATGATTAGAAATC
TTCCAGAGACAAAGTATGGTTGACGTAGACAATTGTAGAACGATAACAAACAGTTACCTT
CTCGGTATGCTGCAGTGAAAATCCATTAGCTGGGAGGGCAAAAAGGAAGAGGACAGTAAA
GAATACCGAGGTAAAGAAGAGGACACTAAAGAATACTGAGGTAATGAAGATGACAGAAAA
ATTACCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
TGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAG
ATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCC
GTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGA
CGTGTCTACATTCA

Last Updated on 07.07.2016 14:16