Sequences from confirmation amplicon


Confirmation sequences for line 432D04 and hit At1g66460 are shown.
Line ID 432D04
Locus At1g66460 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24791259
Primers used for PCR DN27 - 8474, show primer details
   
Sequence Name 20-K101829-0022-432-D04C-8409
GenBank Accession LN495154 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>20-K101829-0022-432-D04C-8409
TTACATTGAATATATCCTGGCCCTTGACCATACTTGTACACCAAGAAAAGCCCTTGATCG
GGATCGATACAGAAACCTAGCAGAGGCACAACGTTGGGGCTATTAAGAGAGCTTGCAATC
ATCAACTCTCTGCAAAACGACTTTGGAGATTCTTTATCTTTTTTATCAAGTCTTTTGATG
GCCACGGCTTTACGCCAAATCCCGATTCTTCCCTTAAAAACATAGCTACAAGCTCCTCTT
CCCAAAACCCTCCCTAACCAATTTCAACACATCTTCCTCAAATACAATTCAAAGATCTAA
CATATCAAAGTACAAAAAAAATAAGAACAATAACAGGACATTTTGAGGGTGTTTTAGGGT
TTACGTTTTGAATTGTNTTTGNGGNAGATGTGTTGTAATTGGTTTGGGTGGGTTTTGGT
   
Sequence Name 64-K101832-0022-432-D04C-DN27
GenBank Accession LN511165 [GenBank]
Sequencing primer gene specific primer, DN27: 5'-TCAAAACGTAAACCCTAAAACACC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K101832-0022-432-D04C-DN27
TTTATTTTGACTTTGATATGTTAGATCTTTGAATTGTATTTGAGGAAGATGTGTTGAAAT
TGGTTAGGGAGGGTTTTGGGAAGAGGAGCTTGTAGCTATGTTTTTAAGGGAAGAATCGGG
ATTTGGCGTAAAGCCGTGGCCATCAAAAGACTTGATAAAAAAGATAAAGAATCTCCAAAG
TCGTTTTGCAGAGAGTTGATGATTGCAAGCTCTCTTAATAGCCCCAACGTTGTGCCTCTG
CTAGGTTTCTGTATCGATCCCGATCAAGGGCTTTTCTTGGTGTACAAGTATGTGTCAAGG
GCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAA
AAATGTAGA

Last Updated on 07.07.2016 14:16