SimpleSearch - Line and FST details


Line specific information

 
Line ID 432D04
Vector Used pAC161
Line Availability only available from NASC (N441416)
Segregation Analysis 50:44:42
Confirmed for Hit At1g66460
Parent of DUPLO pair none
Parent of pair(s) 8031

Gene hit F25L23

 
Sequence (A. th genome BLAST matches underlined)
>28-K018172-022-432-D04-8409
TGATCTGANATTTCCGGACTGAAGCATTTACATTGAATATATCCTCGCAAAAAAAAGATC
TGGTAACATATGGCTTTCTTTCCTTGCGTGTTTACAACATCCATTTTATTTAGCATTTAT
TAAAAATTCTCTTCACTTTTTTTTTTTTTTGGGAAAACCAAAAACCCCCTTTTTTCCCGG
GAAAAAAACCCCCAAAAAAAAAGGAACCCCTTTTTTTAAAGGGGAACCCGGGCCCAAAAA
AAAAATTGGGGAAAAAAGAACCCCAAATGGGGGGGGCCCGGGGAAAAACCCCCCAAAAAA
AAAAAAAAACAAACCTTGCAAAACTTTGGGGCCCCCCCCCT
GenBank Accession BX290018 [GenBank]
Graphic View Graphic view of sequence BX290018 of line 432D04
Predicted Position of Insertion Chr3:21982086 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) F25L23
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g66460

 
Sequence (A. th genome BLAST matches underlined)
>28-K018150-022-432-D04-8409
ATTGATATATCCTNGCCCTTGACACATACTTGTGACACCAAGAAAGCCCTTGAGTCGGAT
CGATACAGAAACCTATGGGATCCTCCCTATAGTGAGACTATGGGATCCTCCCTATAGTGA
GATACTCTGAATTGCCATCTCCCATTTGGACGTGAATGTACACACTATGAGATCCTCCCT
CTAGAGAGAGACTCATCTGGCTCTTGCTTTAGGCAATGAATACAACAGATCATAATTTGT
CGTTTTATCAAATTGTACTTGCAGTTTATAACAACGCTGCCGACATCGGCCTTTCTAAAT
TGAAAGAGCCGTGGGAATTTATCTTTCTTTTTCT
GenBank Accession BX290017 [GenBank]
Graphic View Graphic view of gene At1g66460
Predicted Position of Insertion Chr1:24791255 - go to primer design
BLAST e Value 1e-06
Hit Clone Code (BAC ID) F28G11
Hit Gene Code At1g66460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23