Sequences from confirmation amplicon


Confirmation sequences for line 434F04 and hit At1g77920 are shown.
Line ID 434F04
Locus At1g77920 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29299586
Primers used for PCR XL01 - 8474, show primer details
   
Sequence Name 13-K026133-022-434-F04C-8409
GenBank Accession LN491877 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K026133-022-434-F04C-8409
AATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCTGAACATAAGCCTAAAG
ATACAAAAAAAAAGAGGACTTAGTAGCAACTAACTAAACTATATGAGATTCAATAAAGGG
ACTTGCTTCTACCTTCTTTCTCAAACGACTTTTGCGAGCCGCTTCTCGGTTCTGCGCTAA
ACGCCGTTTCATCTATTGGCATATGACAAAAGAATATCAATCAATATCACAAAAACCACC
ATTTTCTATTATGCATGTATAAAAAAGAAAACATAATTAGCTTTGTTTTGATCTAAACCT
TATCATGAATCCTGCCATCATCATCTTGATTATCATTACTAGAAGGTTGTTCTGCTTCGA
TCTGGTTATGAGAAGAATCATAATTTATCTGCACGTGATTTAAAAACCCATTAGTAAAAA
AACAAGTAACAACAACTTTCAAAAATCAATGAATCTTGAAAGAAGAAAACTAGTTAACCT
TGATGTTGTTGTTGTGATCATCAATTCTAGGATCAACCTGAATAATAGAGGAAGTAGCAG
TATTGGGACTATGATCATTGATATCAGATTTGAAAACATTTCCCCAACCGACAATTTGTT
GAAATGGCT
   
Sequence Name 02-K026236-022-434-F04C-XL01
GenBank Accession LN486884 [GenBank]
Sequencing primer gene specific primer, XL01: 5'-GCATCTTTAAGAGACATGGGAATC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K026236-022-434-F04C-XL01
CATGTAGATTATGAGGCATTTCAACAAATTGTCGGTTGGAGAAATGTTTTCAAATCTGAT
ATCAATGATCATAGTCCCAATACTGCTACTTCCTCTATTATTCAGGTTGATCCTAGAATT
GATGATCACAACAACAACATCAAGGTTAACTAGTTTTCTTCTTTCAAGATTCATTGATTT
TTGAAAGTTGTTGTTACTTGTTTTTTTACTAATGGGTTTTTAAATCACGTGCAGATAAAT
TATGATTCTTCTCATAACCAGATCGAAGCAGAACAACCTTCTAGTAATGATAATCAAGAT
GATGATGGCAGGATTCATGATAAGGTTTAGATCAAAACAAAGCTAATTATGTTTTCTTTT
TTATACATGCATAATAGAAAATGGTGGTTTTTGTGATATTGATTGATATTCTTTTGTCAT
ATGCCAATAGATGAAACGGCGTTTAGCGCAGAACCGAGAAGCGGCTCGCAAAAGTCGTTT
GAGAAAGAAGGTAGAAGCAAGTCCCTTTATTGAATCTCATATAGTTTAGTTAGTTGCTAC
TAAGTCCTCTTTTTTTTTGTATCTTTAGGCTTATGTTCAGCAGGATATATTCAATTGTAA
ATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCATATGGA

Last Updated on 23.10.2014 13:25