SimpleSearch - Line and FST details


Line specific information

 
Line ID 434F04
Vector Used pAC161
Line Availability only available from NASC (N441632)
Segregation Analysis 50:49:36
Confirmed for Hit At1g77920
Parent of DUPLO pair none
Parent of pair(s) 3483, 3519, 83045, 83048, 83049, 83050

Gene hit At1g77920

 
Sequence (A. th genome BLAST matches underlined)
>30-K018189-022-434-F04-8409
TGATCATGAGATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCTGAACATAA
GCCTAAAGATACAAAAAAAAAGAGGACTTAGTAGCAACTAACTAAACTATATGAGATTCA
ATAAAGGGACTTGCTTCTACCTTCTTTCTCAAACGACTTTTGCGAGCCGCTTCTCGGTTC
TGCGCTAAACGCCGTTTCATCTATTGGCATATGACAAAAGAATATCAATCAATATCACAA
AAACCACCATTTTCTATTATGCATGTATAAAAAAGAAAACATAATTAGCTTTGTTTTGAT
CTAAACCTTATCATGAATCCTGCCATCATCATCTTGATTATCATTACTATGGGATCCT
GenBank Accession BX290232 [GenBank]
Graphic View Graphic view of gene At1g77920
Predicted Position of Insertion Chr1:29299586 - go to primer design
BLAST e Value 6e-154
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation bZIP transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03