Sequences from confirmation amplicon


Confirmation sequences for line 437B11 and hit At3g61430 are shown.
Line ID 437B11
Locus At3g61430 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:22734034
Primers used for PCR DU02 - 8474, show primer details
   
Sequence Name 31-K021337-022-437-B11C-8409
GenBank Accession LN499975 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K021337-022-437-B11C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAAGTCATTCCGAGTGTTTGGGTTGTGAAAG
AAGACGATAAAGCTATAATCTTGAGAAAATTGTGTTTAGATTTATAGCTTCTTAGCCTGA
ACTTGTTCCATTTGTATCTGATTCAAGAAATCTCAGAAAGCTACAATCTTGGTGGAATTT
GCAGTTTTCTAATATGAATTGTGTCCTTTAGCCTAATCTTGGAATGTATTTTTTTTATAT
GTAACTCTCAGGTGGACACATCAACCCAGCGGTTACTTTTGGTCTGTTCTTAGCCCGGAA
GCTGTCGCTTACTAGAGCTCTGTACTACATAGTGATGCAGTGCTTGGGAGCTATCTGTGG
TGCTGGAGTGGTTAAAGGGTTCCAGCCTAAGCAATACCAGGCTCTAGGAGGAGGAGCTAA
CAC
   
Sequence Name 32-K021337-022-437-B11C-DU02
GenBank Accession LN500402 [GenBank]
Sequencing primer gene specific primer, DU02: 5'-ACAGTGTTAGCTCCTCCTCCTAGA-3'
Sequence (A. th genome BLAST matches underlined)
>32-K021337-022-437-B11C-DU02
TATTGCTTAGGCTGGAACCCTTTAACCACTCCAGCACCACAGATAGCTCCCAAGCACTGC
ATCACTATGTAGTACAGAGCTCTAGTAAGCGACAGCTTCCGGGCTAAGAACAGACCAAAA
GTAACCGCTGGGTTGATGTGTCCACCTGAGAGTTACATATAAAAAAAATACATTCCAAGA
TTAGGCTAAAGGACACAATTCATATTAGAAAACTGCAAATTCCACCAAGATTGTAGCTTT
CTGAGATTTCTTGAATCAGATACAAATGGAACAAGTTCAGGCTAAGAAGCTATAAATCTA
AACACAATTTTCTCAAGATTATAGCTTTATCGTCTTCTTTCACAACCCAAACACTCGGAA
TGACTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTACAT

Last Updated on 23.10.2014 13:25