SimpleSearch - Line and FST details


Line specific information

 
Line ID 437B11
Vector Used pAC161
Line Availability only available from NASC (N441879)
Segregation Analysis 100:93:70
Confirmed for Hit At3g61430
Parent of DUPLO pair none
Parent of pair(s) 5227, 5274, 5280, 5303, 5330, 7528, 7535, 52866, 89538, 89539, 89540, 89541, 89542, 89543, 89544, 89545, 89554, 89555, 89556, 89557, 89558, 89559, 89560

Gene hit At3g61430

 
Sequence (A. th genome BLAST matches underlined)
>82-K018192-022-437-B11-8409
TGATCTGTAATTTCCCGGACATGAAGCCATTTACATTGAAGTCATTCCGAGTGTTTGGGT
TGTGAAAGAAGACTGATAAAGCTATAATCTTGAGAAAATTGTGTTTAGATTTATAGCTTC
TTAGCCTGAACTTGTTCCATTTGTATCTGATTCAAGAAATCTCAGAAAGCTACAATCTTG
GTGGAATTTGCAGTTTTCTAATATGAATTGTGTCCTTTAGCCTAATCTTGGAATGTATTT
TTTTTATATGTAACTCTCAGGTGGACACATCAACCCAGCGGTTACTTTTGGTCTGTTCTT
AGCCCGGAAGCTGTCGCTCACTATGGGATCCTCCCTAAATGGTGAGAGACAGNTNNNGGG
NTNTGAACAGTCNNTAAGTAACCGCTGGGTTGATGTGTCCACACGAGAGTAAAAAAAGNN
NNNNNTNCANGGCNCGNNNNGCCANGCGNCCCACCCCCNNCNNCCAANCCGCCCCNNANA
CACAACNCANNCCANAACNAAACACCACAACCCCACCCCACAANCGAGAAGGGGCCCCCA
CAACCACACNAAAANAAAACCANAAAAAANTGAAGAGAAACCCCCCACCAGGAAAATNCN
GGAAAAAAACACCAACACACCACACANNACANNAAAAACGATATCNCCGAACCTTCTCCC
CTACCATTCAAAAACACTTATCGGAATAAGGGCCCGGGGGGCGACGCCGCGCGTATAAAT
TGGGCGCAACCATTATCGACGCANCCCCGAGAAGGGGGAAGCCACATTATTCTTCTCCAC
CTTTTTGT
GenBank Accession CR770389 [GenBank]
Graphic View Graphic view of gene At3g61430
Predicted Position of Insertion Chr3:22734034 - go to primer design
BLAST e Value 7e-135
Hit Clone Code (BAC ID) F2A19
Hit Gene Code At3g61430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plasma membrane intrinsic protein 1A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g38760

 
Sequence (A. th genome BLAST matches underlined)
>82-K018182-022-437-B11-8409
GATCATGAGATTCCTGGACATGAGCCATTTACAATTGATATTTCCCGTTCTTGAGGACCT
TTTGTCCTCTTGTGTGTCCAAGAATCATGGAATGTGCTCTGAGCGCTATGGGATCCTCCC
TATAGTGAGAAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGCAGAT
GTCCGCACCGTTATTATA
GenBank Accession FR810228 [GenBank]
Graphic View Graphic view of gene At4g38760
Predicted Position of Insertion Chr4:18094582 - go to primer design
BLAST e Value 3e-08
Hit Clone Code (BAC ID) T9A14
Hit Gene Code At4g38760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF3414)
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03