Sequences from confirmation amplicon


Confirmation sequences for line 440G05 and hit At3g05690 are shown.
Line ID 440G05
Locus At3g05690 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:1678086
Primers used for PCR JW01 - 8474, show primer details
   
Sequence Name 35-K024509-022-440-G05C-8409
GenBank Accession LN501677 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K024509-022-440-G05C-8409
GTAGATTTCCCGGCCGGCATGATCAGTGTTTAACGCTCAAGTTTTATCTATTTGAGGGCA
AAAGAAGTTAAGAGTTTACCAAGTGAGAAAGCTAAGTGCGTTGCAGAGTTGCTCTGTTTA
TCCACACGTTGTCCTGTCTCTCCGACAGATCCGACCTTAACTCCGGCGAATGAGTCAGAA
TCGCCGGCGAGACTCTCCGGAGCCAACGGCTGAGATCCAAAAGCAGTCCACCAAGAAGTC
TGTGGAGCAGAGAAGAGACCTTCTCTCACAGTTTGCATAGCCATCTCCAAATTCCAATTA
CAAAAAGTGAAAAATAGATAGTGCCTAGAAGAATAAGAAAGATATGTTCCTGTGGAAGAT
AACAAAAAAAAAAAAGTCAACAAAGTAATAATAAGAGTTGGATGTGAAATCTTTGTCAAA
TTTCAAACCCAATTTAGAAAACTTGTAAGAAAGAAAGGAAAGAACTTTGGGATTGGGTAT
TACGCAA
   
Sequence Name 36-K024509-022-440-G05C-JW01
GenBank Accession LN502073 [GenBank]
Sequencing primer gene specific primer, JW01: 5'-TGCTATTGGGGATCTCTAGTCTGT-3'
Sequence (A. th genome BLAST matches underlined)
>36-K024509-022-440-G05C-JW01
AAAGATTTCAGCTCTTGCGTCTTATCTTCTCGTTTCACACAATCTTTTTTTCTTACTTTA
GACAACAAGTCTGTCTCTTGATGATGATTCACATATGGGTTTTGTCATTCGTGTGGTTTT
GCGTAATACCCAATCCCAAAGTTCTTTCCTTTCTTTCTTACAAGTTTTCTAAATTGGGTT
TGAAATTTGACAAAGATTTCACATCCAACTCTTATTATTACTTTGTTGACTTTTTTTTTT
TTGTTATCTTCCACAGGAACATATCTTTCTTATTCTTCTAGGCACTATCTATTTTTCACT
TTTTGAAATTGGAATTTGGAAATGGCTATGCAAACTGGGAGAAAAGGTCTTTTCTCTGCT
CCACAAACTTCTGGGGGGACTGCTTTTGGATCTCACCCGTTGGCTCCGGAAAGTCTCGCC
GGCAATTCTGACTCATTCCCCGGAGTTAAGGTCGGATCTGT

Last Updated on 07.07.2016 14:16