SimpleSearch - Line and FST details


Line specific information

 
Line ID 440G05
Vector Used pAC161
Line Availability only available from NASC (N442221)
Segregation Analysis 50:43:37
Confirmed for Hit At3g05690
Parent of DUPLO pair none
Parent of pair(s) 6823

Gene hit At3g05690

 
Sequence (A. th genome BLAST matches underlined)
>39-K018208-022-440-G05-8409
ATTTCCCGGCCGGCATGATCAGTGTTTAACGCTCAAGTTTTATCTATTTGAGGGCAAAAG
AAGTTAAGAGTTTACCAAGTGAGAAAGCTAAGTGCGTTGCAGAGTTGCTCTGTTTATCCA
CACGTTGTCCTGTCTCTCCGACAGATCCGACCTTAACTCCGGCGAATGAGTCAGAATCGC
CGGCGAGACTCTCCGGAGCCAACGGCTGAGATCCAAAAGCAGTCCACCAAGAAGTCTGTG
GAGCAGAGAAGAGACCTTCTCTCACAGTTTGCATAGCCATCTCCAAATTCCAATTACAAA
AAGTGAAAAATAGATAGTGCCTATGGGATCCTCCNTTATAGTGAG
GenBank Accession BX290870 [GenBank]
Graphic View Graphic view of gene At3g05690
Predicted Position of Insertion Chr3:1678086 - go to primer design
BLAST e Value 4e-158
Hit Clone Code (BAC ID) F18C1
Hit Gene Code At3g05690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit A2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T28I19

 
Sequence (A. th genome BLAST matches underlined)
>39-K018216-022-440-G05-8409
TGATCTGTAGATTTCCCGGACATGAAGTCGTTGAGCATTGATATCTATCTGGCCTTCTAT
GGGATCCTCCCTATATATGAGAGTTGTTTTATTTATACCATATAAAAATTGATAAGAGAA
TGTGGTGTAATTTATTAGCTTGATTAGCTAATGTGGTGTAATTTATTGATAAGAGAAGGA
GATCAATTATTGATTAGCTTGGATGTGTATATCCACACATATAGTATTACCAAATAATCG
ACTTAAAACAGCAAGAACTTGACAAAAAATACCAAAATTTAGTTTAATTTTGCATGAAAG
TGATCACGAGACAGATTTTCTCGTGTGAATGATTTTGTTGGAAGTAAAAAAGGATAGTGG
GAGCAGTTGTTTAGGAGGGAAATCATAAGCACGAAGAGGTCCCTCTCTCCTTCCTTTGAT
TTTGGTAATGATTATAAATTCCACCAAACATATATACCATTTTTAATAATCCAATTTTAG
TGTCATTTATGTCTTTTCGACAATAGTTTTCTTGCCTTTTTTTTCTTTCTTTTCGAATAT
TAGTTTTCTTGATTACACTCTCACTCTGAGAAAATTAGTCAAACAACGACTTAAGAAAAA
AAGTCAACAACCGCCAAAGTTGCGACGGAGAACGCANACGTGAAACGCTTG
GenBank Accession BX290871 [GenBank]
Graphic View Graphic view of sequence BX290871 of line 440G05
Predicted Position of Insertion Chr4:17737243 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T28I19
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23