Sequences from confirmation amplicon


Confirmation sequences for line 446D11 and hit At2g32440 are shown.
Line ID 446D11
Locus At2g32440 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13777673
Primers used for PCR NE16 - 8474, show primer details
   
Sequence Name 87-K102437-0022-446-D11C-8409
GenBank Accession LN514750 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>87-K102437-0022-446-D11C-8409
TTGAATAATCCTGTAGTTTAACTATCAGTGCGAAAAACTGGCATAATCACAGGGTGGAAA
GGAGCAATCCCGGATGTCCGGTGATGTTCTTGCCTCACAATCGACCCAAAGATAATTGCC
TAGCAAGAATCACCAGAACGATGCCATAATCATCATCTTCAAACTAGTAGACCCCTTAGC
AAATATATAAGCTTCGTCTCAGGTTTCCATTGTCTTCATCTTCTCTTAGAACTTGATCCA
AACCGGTTCGGTTTGTGAATTTGGTTTACTAGGATGTATCAATAGTTTGAAGGATTTGTC
AAAGTAATGTTGAAATTTTTCTCTGGTTTAGCTTCANATTTGGT
   
Sequence Name 87-K102438-0022-446-D11C-NE16
GenBank Accession LN514751 [GenBank]
Sequencing primer gene specific primer, NE16: 5'-AACCAAATTTGAAGCTAAACCAGA-3'
Sequence (A. th genome BLAST matches underlined)
>87-K102438-0022-446-D11C-NE16
ATCCTTCAACTATTGATACATCCTAGTAAACCAAATTCACAAACCGAACCGGTTTGGATC
AAGTTCTAAGAGAAGATGAAGACAATGGAAACCTGAGACGAAGCTTATATATTTGCTAAG
GGGTCTACTAGTTTGAAGATGATGATTATGGCATCGTTCTGGTGATTCTTGCTAGGCAAT
TATCTTTGGGTCGATTGTGAGGCAAGAACATCACCGGACATCCGGGATTGCTCCTTTCCA
CCCTGTGATTATGCCAGTTTTTCGCACTGATAGTTTAAACTACAGGATATATTCAATTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT
CACTCCCAAAATGG

Last Updated on 23.10.2014 13:25