SimpleSearch - Line and FST details


Line specific information

 
Line ID 446D11
Vector Used pAC161
Line Availability only available from NASC (N442767)
Segregation Analysis 50:36:36
Confirmed for Hit At2g32440
Parent of DUPLO pair 2497
Parent of pair(s) none

Gene hit F8M21

 
Sequence (A. th genome BLAST matches underlined)
>84-K023804-022-446-D11-8409
ACATAATACATTCTAGTACCATTAATTGATGACGAAGCCTGAACTAATAATCGAGAGAAT
TTCATAACATAGTCAAGATACATTCATTAAGTACTCTAATTCTTCTGATATGTTTCCAGA
GAAAAACCAGATCTATGGGATCCTCCCTATAGTGAGACNNANTACTCNNNNNNNNNNNNN
NNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNTN
NNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTNTTTTTTNNNNTTTNNTTTTTTNNTTTTNTTTTTNNTTTTTT
TTTNAATTTTTTNTTNNTTTTTNTTTTTTTTTTTTNTTTNNTAATACTTTTTTTTCCTCT
CTATATTGAGCACCCATTACACCAAAAAATACCTCAAAATC
GenBank Accession BX891128 [GenBank]
Graphic View Graphic view of sequence BX891128 of line 446D11
Predicted Position of Insertion Chr5:4944265 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) F8M21
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g32440

 
Sequence (A. th genome BLAST matches underlined)
>84-K023729-022-446-D11-8409
ATGAACCATTTACAATTGAATATATCCTGTACTTTAAACTATCAGTGCGAAAAACTGGCA
TAATCACAGGGATGGAAAGGAGCCATCCCGGATGTCCGGTGATGTTCTTGCCTCACAATC
CACCCAAAGATAATTGCCTATGGGATCCTCCCTATAGTGAGTCNTATTACTCCTTCCTCT
GATCTGATTTTTTAAACCAACCAGATCTGGGGGGTGCGCAACCCAATAATTAAAATTCTC
TACACTTGCAAATGTTACCATTATACAATATCGCCCACCGTAGACCCGACGACATAAAAA
AAATTGTCTCTACTCCAAATAATAACACCCAAGCTAGACAATTAAACACTACTATCAG
GenBank Accession BX891127 [GenBank]
Graphic View Graphic view of gene At2g32440
Predicted Position of Insertion Chr2:13777656 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) T32F6
Hit Gene Code At2g32440 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ent-kaurenoic acid hydroxylase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23