Sequences from confirmation amplicon


Confirmation sequences for line 450D10 and hit At1g14520 are shown.
Line ID 450D10
Locus At1g14520 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:4968531
Primers used for PCR MP37 - 8474, show primer details
   
Sequence Name 01-K023022-022-450-D10C-8409
GenBank Accession LN486404 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K023022-022-450-D10C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGATACCGTCACC
AGGCGGCCGTTCTTGGCCTTCTTCGTAAGCCAATCCCCGGGTACCCTGTCCTCTCCAAAT
GAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCAT
CCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAACACTTCCTCAACGTTT
ACGCGGACTTTGCTTTTGCTGTAGAGATCATACTTGTTGAACACTTTAAGCCACTTCATG
TTCTCTCTGTCTTCATTGTTCATCAAATGCTTGTATGCTTCTGATTTGTGAAGAGCTGCC
AACCAAAAACAATAACAATAACCCGTAGTTTTATAATCTAGACTCATCTATTAACCAATA
AATTCAAGCAAATCAGTCTTTGTGTTTCAAATACCGTAGAACGAATGGTATCTGATGATG
AAAAGACCGGCTGATGGTAAAGTAGTTTGATTC
   
Sequence Name 02-K023022-022-450-D10C-MP37
GenBank Accession LN486859 [GenBank]
Sequencing primer gene specific primer, MP37: 5'-GTTGCGAAGGAGAATCAAACTACT-3'
Sequence (A. th genome BLAST matches underlined)
>02-K023022-022-450-D10C-MP37
TTTTCATCATCAGATACCATTCGTTCTACGGGATTTGAAACACAAAGACTGATTTGCTTG
AATTTATTGGTTAATAGATGAGTCTAGATTATAAAACTACGGGTTATTGTTATTGTTTTT
GGTTGGCAGCTCTTCACAAATCAGAAGCATACAAGCATTTGATGAACAATGAAGACAGAG
AGAACATGAAGTGGCTTAAAGTGTTCAACAAGTATGATCTCTACAGCAAAAGCAAAGTCC
GCGTAAACGTTGAGGAAGTGTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTA
AGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCA
TTTCATTTGGAGAGGACAGGGTACCCGGGGATTGGCTTACGAAGAAGGCCAAGAACGGCC
GCCTGGTGACGGTATCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATT
TTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTG
ATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCT
AATTCGGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25