SimpleSearch - Line and FST details


Line specific information

 
Line ID 450D10
Vector Used pAC161
Line Availability only available from NASC (N443150)
Segregation Analysis 100:87:87
Confirmed for Hit At1g14520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g14520

Sequence (A. th genome BLAST matches underlined)
>76-K019252-022-450-D10-8409
TGTCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTAGGATACCGACA
CCGAGCGAGCTCGTTCTTGGGCTTCTTCGATACCAATCCCCGGGAACCCTGTCCTCTCCA
AATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGT
CATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAACACTTCCTCAACG
TTTACGCGGACTTTGCTTTTGCTGTAGAGATCATACTTGTTGAACACTTTAAGCCACTTC
ATGTTCTCTCTGTCTTCATTGTTCATCAAATGCTTGTATGCTTCTGATTTGTGAAGAGCT
GCCAACCAAAAACAATAACAATAACCCGTAGTTTTATAATCTATGGGATCCCCNNATTAG
TGAGACTATNNGATCCTCCCTATACCGATGCTATGTGATTCTCCCTATACTAAGGCTATA
ACATCCTCCTAATATTGATCTACACTGAATTGACAACTCCCATTTGGACGTGGATGTAGA
CAC
GenBank Accession BX292036 [GenBank]
Graphic View Graphic view of gene At1g14520
Predicted Position of Insertion Chr1:4968362 - go to primer design
BLAST e Value 7e-95
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myo-inositol oxygenase 1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Kanter et al. 2005, Dmiox1-1]


Last Updated on 07.07.2016 14:03