Sequences from confirmation amplicon


Confirmation sequences for line 468B04 and hit At2g38730 are shown.
Line ID 468B04
Locus At2g38730 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:16194095
Primers used for PCR JK31 - 8474, show primer details
   
Sequence Name 27-K025043-022-468-B04C-8409
GenBank Accession LN498219 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K025043-022-468-B04C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAAGGAGCAAAAAGGTTTTGCCGAAGTTGAG
AGATCAATCAAAGATTTGAAGTTCCGATGAATTCAGGAGGTGGAATCGTTGCTGCAGCAG
CTCCTTCAAGCGGCGGTGGTAATGTTGAATGGCATGTCCGACCACCGAACCCTAAAAACC
CAGTTGTCTTCTTCGACGTCTCTATTGGTGGTATCCCCGCCGGTCGTATCAAGATGGAGC
TCTTCGCCGACATTGCTCCCAAAACCGCTGAAAACTTCAGGCAGTTCTGTACTGGTGAAC
TCAGGTACTCGATTCTGTTTCTTTTTAATGTTTACTCCATTCGATTCTCTATCTTCGT
   
Sequence Name 28-K025043-022-468-B04C-JK31
GenBank Accession LN498686 [GenBank]
Sequencing primer gene specific primer, JK31: 5'-AACGAAGATAGAGAATCGAATGGA-3'
Sequence (A. th genome BLAST matches underlined)
>28-K025043-022-468-B04C-JK31
CATTAAAAAGAAACAGAATCGAGTACCTGAGTTCACCAGTACAGAACTGCCTGAAGTTTT
CAGCGGTTTTGGGAGCAATGTCGGCGAAGAGCTCCATCTTGATACGACCGGCGGGGATAC
CACCAATAGAGACGTCGAAGAAGACAACTGGGTTTTTAGGGTTCGGTGGTCGGACATGCC
ATTCAACATTACCACCGCCGCTTGAAGGAGCTGCTGCAGCAACGATTCCACCTCCTGAAT
TCATCGGAACTTCAAATCTTTGATTGATCTCTCAACTTCGGCAAAACCTTTTTGCTCCTT
CAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGT
ATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGT
CTACATTCA

Last Updated on 07.07.2016 14:16