SimpleSearch - Line and FST details


Line specific information

 
Line ID 468B04
Vector Used pAC161
Line Availability only available from NASC (N444848)
Segregation Analysis 50:31:29
Confirmed for Hit At2g38730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g38730

 
Sequence (A. th genome BLAST matches underlined)
>26-K019015-022-468-B04-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATGATCACTAGGGTCTTGC
CGAGATTGACAGATCTATCGAAGATTTGAAGTGCCGATGAATTCAAGAGGAGGAATCGTT
GCTGCATCAGCTCCTTCAAGCGGCGGTGGTAATGTTGAATGGCATGTCCGACCACCGAAC
CCTAAAAACCCAGTTGTCTTCTTCGACGTCTCTATTGGTGGGATCCCCGCCGGACGAATC
AAGATGGAGCTCTTCGCCGACATTGCTCCCAAAACCGCTGAAAACTTCAGGCAGTTCTGT
ACTGGTGAACTCAGGTACTCGATTCTGTTTCTTTTTAATGTTTACTCCATTCGATTCTCT
ATCTTCGTTCCTGCATCTTATTCGTTTGAGGTTGAATTTACGATTTAGTATTTGAAATTT
AGCGTCTTCTCAAGAGGTTTTAGAGCTTTTTTTTTGGATTCATATAGTTTTGAGCTTGCT
GCTTCGTTTATGCTTCAGTCTACAGATTGAATTGTTTATGCCTAACTATTGAACTTTGCT
ATGGGACTCCC
GenBank Accession BX291815 [GenBank]
Graphic View Graphic view of gene At2g38730
Predicted Position of Insertion Chr2:16194078 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T6A23
Hit Gene Code At2g38730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03