Sequences from confirmation amplicon


Confirmation sequences for line 471D01 and hit At4g11460 are shown.
Line ID 471D01
Locus At4g11460 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:6967047
Primers used for PCR NC59 - 8474, show primer details
   
Sequence Name 11-K101324-0022-471-D01C-8409
GenBank Accession LN491044 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K101324-0022-471-D01C-8409
CTTTACATTGTAATACAACAGAGTGCAGAAGCAAGAGTTTTACCGAGGAGTGTAGTGATT
GTTGCATTGTCGATAGAACAAGTAACAGATTCATTGTTATATTGGTCTGGCTCCAATCCA
CGGCGTAATGTGTCTGACTCAGGTCTGTTCCTGAAGAAAAATCCAGGTGGTTGAGGGACA
TTTAGAGTAATGGAGCTATTAGTGAGCATTTGGAATATTGTAGACAATGCTGGTCGATTC
ACAGGATTTTCTTGAACGCATAAAAGTCCGATATGGATGCATCTAGTGACTTCATCTTTC
TCATAGCTTCCGCTAATCGCCGGATCTACGAGCTCTAAAGATGAATCAGTGTTCCAAAGT
CTCCAAACCTGCAAACAAACTCGTATTCAGAATCGATGATCACAGTTAGAAAGTAAAAAA
AGCATTTTAGATTTCAGCTCACATATGTGACCAAGTTGCAAACAGAACCATCCATCTGAT
AGAAGCTGCTATTCTTCCTGCCACTAACAATCTCTAGAATCAATACTCCGAAGCTATAGA
CATCGGATTTGGTAGAGAATTGGCCATGCGCAACATATTCTGGAGGCATGTAACCGCTGC
AAATA
   
Sequence Name 11-K101341-0022-471-D01C-NC59
GenBank Accession LN491045 [GenBank]
Sequencing primer gene specific primer, NC59: 5'-TGTCATGTATATATTTGCAGCGGT-3'
Sequence (A. th genome BLAST matches underlined)
>11-K101341-0022-471-D01C-NC59
GCAGGCCATTCTCTACCAAATCCGATGTCTATAGCTTCGGAGTATTGATTCTAGAGATTG
TTAGTGGCAGGAAGAATAGCAGCTTCTATCAGATGGATGGTTCTGTTTGCAACTTGGTCA
CATATGTGAGCTGAAATCTAAAATGCTTTTTTTACTTTCTAACTGTGATCATCGATTCTG
AATACGAGTTTGTTTGCAGGTTTGGAGACTTTGGAACACTGATTCATCTTTAGAGCTCGT
AGATCCGGCGATTAGCGGAAGCTATGAGAAAGATGAAGTCACTAGATGCATCCATATCGG
ACTTTTATGCGTTCAAGAAAATCCTGTGAATCGACCAGCATTGTCTACAATATTCCAAAT
GCTCACTAATAGCTCCATTACTCTAAATGTCCCTCAACCACCTGGATTTTTCTTCAGGAA
CAGACCTGAGTCAGACACATTACGCCGTGGATTGGAGCCAGACCAATATAACAATGAATC
TGTTACTTGTTCTATCGACAATGCAACAATCACTACACTCCTCGGTAAAACTCTGGCTTC
TGCACTCTGTTGTATTACAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCANAAATGTAGATGTCCG

Last Updated on 07.07.2016 14:16