SimpleSearch - Line and FST details


Line specific information

 
Line ID 471D01
Vector Used pAC161
Line Availability only available from NASC (N445157)
Segregation Analysis 50:16:14
Confirmed for Hit At4g11460
Parent of DUPLO pair none
Parent of pair(s) 10286, 10292, 10296, 10299, 10312, 10328, 10332, 75322, 75438, 75461, 75520, 75525, 75529

Gene hit At4g11460

 
Sequence (A. th genome BLAST matches underlined)
>04-K019883-022-471-D01-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTAAATTGAATTTTTCGGAATGTGCAAATAA
GAGTTTTACCGAGGAGTGTAATGATTGTTGCATTGTCTATACAACAAGTAACCGATTCAT
TGTTATATTGGTCTGGCTGCCAATCCACGGCGTAATGTGTCTGACTCCGGTCTGTTCCTG
AATAAAAATCCTGGTGGTTGACGGACATTTAGAGTAATGGAGCTATTAGTGAGCATTCGG
AATATTGTAGACAATGCTGGTCGATTCACAGGATTTTCTTGAACGCATAAAAGTCCGATA
TGGATGCATCTATGGCATCCTCCCCTATAGAGAG
GenBank Accession BX531014 [GenBank]
Graphic View Graphic view of gene At4g11460
Predicted Position of Insertion Chr4:6967024 - go to primer design
BLAST e Value 4e-115
Hit Clone Code (BAC ID) F25E4
Hit Gene Code At4g11460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cysteine-rich RLK (RECEPTOR-like protein kinase) 30
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531013 [GenBank]


Last Updated on 31.08.2016 09:40