Sequences from confirmation amplicon


Confirmation sequences for line 479A12 and hit At1g47560 are shown.
Line ID 479A12
Locus At1g47560 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:17466756
Primers used for PCR DN30 - 8474, show primer details
   
Sequence Name 22-K101829-0022-479-A12C-8409
GenBank Accession LN496057 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K101829-0022-479-A12C-8409
CCATTACAAGTCAAGCGCCGACGATGAAGAGCTTCGGCGAGCTTGCGAGGCGGCAATCGA
AGGCACCAAGCAATCGATCGTCATGTCGATACGTGTGGCCAAGAGTCGCGGTGTTTGGGG
CAAGTCTGGAAAATTGGGTCGACAAATGGCTAAACCCAGAGTTCTCGCTCTTTCCGGTGA
TAGAACCTTACCTTCTTCTTCTCTCTTTTGATTGTTCTGATTTGATTCATTTCACTTTTA
ATTACTTCGACCTTCTTCGCGTTGATTGGCTAGTTCTAAGCATTTAGATTCGGTGATTAT
GGAATTTAGAGAATCTGTTGAATACTAAATCGATGAAATTCTACTGTTCTTGGCCATTTT
ATGACTCGTGAGAGCTCAATTAGGTTTTCCTGAGCAACAAAAAGGAATTCTGGTA
   
Sequence Name 66-K101832-0022-479-A12C-DN30
GenBank Accession LN511570 [GenBank]
Sequencing primer gene specific primer, DN30: 5'-CTACCAGAATCCTTTTTGTTGCTC-3'
Sequence (A. th genome BLAST matches underlined)
>66-K101832-0022-479-A12C-DN30
GTAGAATTCATCGATTTAGTATTCAACAGATTCTCTAAATTCCATAATCACCGAATCTAA
ATGCTTAGAACTAGCCAATCAACGCGAAGAAGGTCGAAGTAATTAAAAGTGAAATGAATC
AAATCAGAACAATCAAAAGAGAGAAGAAGAAGGTAAGGTTCTATCACCGGAAAGAGCGAG
AACTCTGGGTTTAGCCATTTGTCGACCCAATTTTCCAGACTTGCCCCAAACACCGCGACT
CTTGGCCACACGTATCGACATGACGATCGATTGCTTGGTGCCTTCGATTGCCGCCTCGCA
AGCTCGCCGAAGCTCTTCATCGTCGGCGCTTGACTTGTAAATGGCTTCATGTCCGGGAAA
TCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACC
AATTTTTTTTCAATTCAAAAATGTAGATGTCCG

Last Updated on 07.07.2016 14:16