SimpleSearch - Line and FST details


Line specific information

 
Line ID 479A12
Vector Used pAC161
Line Availability only available from NASC (N445900)
Segregation Analysis 50:30:21
Confirmed for Hit At1g47560
Parent of DUPLO pair none
Parent of pair(s) 12147

Gene hit At1g47560

 
Sequence (A. th genome BLAST matches underlined)
>89-K019030-022-479-A12-8409
GTCACGCGTCTACGATGATCAGCTTCGGCGAGCTTGCGAGGCGGCAATCGAAGGCACCAA
GCAATCGATCGTCATGTCGATACGTGTGGCCAAGAGTCGCGGTGTTTGGGGCAAGTCTGG
AAAATTGGGTCGACAAATGGCTAAACCCAGAGTTCTCGCTCTTTCCGGTGATAGAACCTT
ACCTTCTTCTTCTCTCTTTTGATTGTTCTGATTTGATTCATTTCACTTTTAATTACTTCG
ACCTTCTTCGCGTTGATTGGCTATGGGATCCTCCCTATAGTGAGAG
GenBank Accession BX293456 [GenBank]
Graphic View Graphic view of gene At1g47560
Predicted Position of Insertion Chr1:17466770 - go to primer design
BLAST e Value 2e-135
Hit Clone Code (BAC ID) F16N3
Hit Gene Code At1g47560 [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst complex component sec3B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23