Sequences from confirmation amplicon


Confirmation sequences for line 486C08 and hit At3g17270 are shown.
Line ID 486C08
Locus At3g17270 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:5902489
Primers used for PCR HF47 - 8474, show primer details
   
Sequence Name 47-K101326-0022-486-C08C-8409
GenBank Accession LN506147 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>47-K101326-0022-486-C08C-8409
ATTTACATTGAATATATCCTGGAAATATTGAAGTGGTTCATTACTCCACCACATAATTTG
GATATGCGGTTAGATTTGAGTTTCGCGTACATTGTGTTAAGGCTTCTTGCCAAGTTTGCC
TCCTTTGATACTTTGACGTCTTTCGAATCAATTAGACTCCTGAGTTTACCTGAAAACTCC
ATAGATGGTTCAAATCTGTCGTCAATTCCATGGCGATTGACGCTAATTGAGTGAACCCTA
TCATTCATCAGTAACATCACTTCCCTCGCTGATTTACACAAGTTCTTCTTCACGAATCTC
GGATCTCTGAACAAAGCGTACCATCGTTTGCAAATAGTCTTCCATTTCGCTAGAGACTTC
GCCGGAACCCTAGAGAGTATTTCCGATTCCNATTCGTCTGGAAGATTGGGAATCGTTGTC
ATCATCGTCTTTTTTGAAGAAGAACTGGGATAAGGGAAAGGTAAGTAGAANAGCTTTTCT
TATTGATCTTTATCTGATAGTGAATTTCGATTACNACTGAGGTACTTTATATAGACTACT
CATTATAGGGTTTCTCTTTTTACAGCTGTTAATCTTGTCATCAACAAAGAGCCATGAGAG
CTTCATAACGGTNAGATAGTATCATTTGGCTGTCTCCTTGA
   
Sequence Name 47-K101332-0022-486-C08C-HF47
GenBank Accession LN506148 [GenBank]
Sequencing primer gene specific primer, HF47: 5'-CAAAAGCATATGTTCAAGGAGACA-3'
Sequence (A. th genome BLAST matches underlined)
>47-K101332-0022-486-C08C-HF47
TACCGTTATGAGCTCTCATGGCTCTTTGTTGATGACAAGATTAACAGCTGTAAAAAGAGA
AACCCTATAATGAGTAGTCTATATAAAGTACCTCAGTTGTAATCGAAATTCACTATCAGA
TAAAGATCAATAAGAAAAGCTTTTCTACTTACCTTTCCCTTATCCCAGTTCTTCTTCAAA
AAAGACGATGATGACAACGATTCCCAATCTTCCAGACGAATTGGAATCGGAAATACTCTC
TAGGGTTCCGGCGAAGTCTCTAGCGAAATGGAAGACTATTTGCAAACGATGGTACGCTTT
GTTCAGAGATCCGAGATTCGTGAAGAAGAACTTGTGTAAATCAGCGAGGGAAGTGATGTT
ACTGATGAATGATAGGGTTCACTCAATTAGCGTCAATCGCCATGGAATTGACGACAGATT
TGAACCATCTATGGAGTTTTCAGGTAAACTCAGGAGTCTAATTGATTCGAAAGACGTCAA
AGTATCAAAGGAGGCAAACTTGGCAAGAAGCCTTAACACAATGTACGCGAAACTCAAATC
TAACCGCANATCCNAATTATGTGGTGGAGTAATGAACCACTTCAATATTTCCAGGATATA
TTCAATTGTAAATGGCTTCATGTCCGGGGAATCTACATGGATCAGCAATGAGTATGATGG
TCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATGTAGATG
TCCG

Last Updated on 23.10.2014 13:25