SimpleSearch - Line and FST details


Line specific information

 
Line ID 486C08
Vector Used pAC161
Line Availability only available from NASC (N446592)
Segregation Analysis 50:29:21
Confirmed for Hit At3g17270
Parent of DUPLO pair none
Parent of pair(s) 68619, 97169, 97170

Gene hit At3g17270

 
Sequence (A. th genome BLAST matches underlined)
>59-K019564-022-486-C08-8409
GCATGCATGTCGACCTTATGGGATCCTGCCTATAGTGAGACATAGTTTGGATATGCGGTT
AGATTTGAGTTTCGCGTACATTGTGTTAAGGCTTCTTGCCAAGTTTGCCTCCTTTGATAC
TTTGACGTCTTTCGAATCAATTAGACTCCTGAGTTTACCTGAAAACTCCATAGATGGTTC
AAATCTGTCGTCAATTCCATGGCGATTGACGCTAATTGAGTGAACCCTATCATTCATCAG
TAACATCACTTCCCTCGCTGATTTACACAAGTTCTTCTTCACGAATCTCGGATCTCTGAA
CAAAGCGTACCATCGTTTGCAAATAGTCTTCCATTTCACTATGGGATCCTCCCCTATAGT
GAGAGGATCCTCCCTATAGCGAG
GenBank Accession BX532043 [GenBank]
Graphic View Graphic view of gene At3g17270
Predicted Position of Insertion Chr3:5902495 - go to primer design
BLAST e Value 3e-165
Hit Clone Code (BAC ID) MGD8
Hit Gene Code At3g17270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR811001 [GenBank]


Last Updated on 14.10.2014 10:23