Sequences from confirmation amplicon


Confirmation sequences for line 496A08 and hit At3g56090 are shown.
Line ID 496A08
Locus At3g56090 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20816032
Primers used for PCR CC10 - 8474, show primer details
   
Sequence Name 11-K026963-022-496-A08C-8409
GenBank Accession LN490959 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K026963-022-496-A08C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCCGGACATCATACTCATTT
ACAATTAATGAAGCCATGTAGACCACAAAACCCTTTCTCCTCCAATTTCGTCGCACACAG
GAAAACAAAATGCTTCTCAAAGCTGCTTCTACTTTCTCTCTATTGAACATTCATGGAGAG
AAGAAAGACATCTCTCCTCTCTTCTCCTCCTCCTCCTCCATTTCGTCTCCGGTTTCTTCT
GGAAAATCCGGCAATCTCTCTTTCCCTCTTCGTGCTTCCAAGAGTTCAACCACTACCACA
AGCACGTTGAGCGGCGTTGTGTTCGAGCCTTTCGAAGAGGTTAAGAAAGAGATGGATCTA
GTTCCATCTGGTCAACAGCTTTCTCTTGCTCGTCATTTGTACTCCCCTGAGTGCGAAGCC
GCCGTCAATGAGCAGATCAAGTACGTTTTTCCGTCTTGGATTGAAACATTTTAGTGATTG
TTATCATGGATTTGAAAATTGTTATTGTAAATCTGTTGATTGAGTCAATTTTTGCTTGAA
TCCTATATAGATGAGATTGGCTTTTATTTTGAGTCTCTCATGAATCTGGATTTTCGTTTG
ATGCAG
   
Sequence Name 15-K026963-022-496-A08C-CC10
GenBank Accession LN492817 [GenBank]
Sequencing primer gene specific primer, CC10: 5'-ACGACACGTTATACTCAACACTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K026963-022-496-A08C-CC10
ATCAAACGAAAATCCAGATTCATGAGAGACTCAAAATAAAAGCCAATCTCATCTATATAG
GATTCAAGCAAAAATTGACTCAATCAACAGATTTACAATAACAATTTTCAAATCCATGAT
AACAATCACTAAAATGTTTCAATCCAAGACGGAAAAACGTACTTGATCTGCTCATTGACG
GCGGCTTCGCACTCAGGGGAGTACAAATGACGAGCAAGAGAAAGCTGTTGACCAGATGGA
ACTAGATCCATCTCTTTCTTAACCTCTTCGAAAGGCTCGAACACAACGCCGCTCAACGTG
CTTGTGGTAGTGGTTGAACTCTTGGAAGCACGAAGAGGGAAAGAGAGATTGCCGGATTTT
CCAGAAGAAACCGGAGACGAAATGGAGGAGGAGGAGGAGAAGAGAGGAGAGATGTCTTTC
TTCTCTCCATGAATGTTCAATAGAGAGAAAGTAGAAGCAGCTTTGAGAAGCATTTTGTTT
TCCTGTGTGCGACGAAATTGGAGGAGAAAGGGTTTTGTGGTCTACATGGCTTCATTAATT
GTAAATGAGTATGATGTCCGGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATC
TACATGGATCAGCAATGAGTATGA

Last Updated on 23.10.2014 13:25