SimpleSearch - Line and FST details


Line specific information

 
Line ID 496A08
Vector Used pAC161
Line Availability only available from NASC (N447528)
Segregation Analysis 50:14:9
Confirmed for Hit At3g56090
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g56090

 
Sequence (A. th genome BLAST matches underlined)
>57-K019655-022-496-A08-8409
TGATCTGTAGATTTCCGGACATGAAGCCGTTTACATTGACTATATATCCGGACCTCCTAA
TCGTGTGCATTAATGAAGCCATGTAGACCACAAAACCCTTTCTCCTCCAATTTCGTCGCA
CACAGGAAAACAAAATGCTTCTCAAAGCTGCTTCTACTTTCTCTCTATTGAACATTCATG
GAGAGAAGAAAGACATCTCTCCTCTCTTCTCCTCCTCCTCCTCCATTTCGTCTCCGGTTT
CTTCTGGAAAATCCGGCAATCTCTCTTTCCCTCTTCGTGCTTCCAAGAGTTCAACCACTA
CCACAAGCACGTTGAGCGGCGTTGTGTTCGAGCCTTTCGAAGAGGTTAAGAAAGAGATGG
ATCTATGGGATCCTCCCNTAATAGTGAGACTGGGCAATGGAATCCTAGGAGGTTTCCGGA
TATTACCCTTTGCTGAAAAGGCTCAATTGCCCTTTGGGCTTCTGAGACTGTATCTTTGAT
ATTTTTGGAGTAGACAAGCGTGTCCTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTC
ATTGAGTCGTAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAG
GTCCTCTATTTGAATCTTTGACTCCATGGGAATTGGGGATCCCCTATGG
GenBank Accession BX532910 [GenBank]
Graphic View Graphic view of gene At3g56090
Predicted Position of Insertion Chr3:20816060 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) F18O21
Hit Gene Code At3g56090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferritin 3
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX532909 [GenBank]


Last Updated on 07.07.2016 14:03