Sequences from confirmation amplicon


Confirmation sequences for line 502A02 and hit At3g26120 are shown.
Line ID 502A02
Locus At3g26120 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:9547884
Primers used for PCR CC07 - 8474, show primer details
   
Sequence Name 47-K023620-022-502-A02C-8409
GenBank Accession LN506066 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>47-K023620-022-502-A02C-8409
AAATTTCCCGGACATGAAGCCATTTACAATTGAATATACCAAACAAGTACAGGTTGGGCT
TTATAATCTAATTTATTTAGTATATTATAATATTTGAAAGTTTTTCAATTATTCTCTAAG
AAACTAAAGACTAAATCTTTCTAATCTTCAATAAAGTAATTATATGGATTTAAAGTTCGA
AGCTTTTGCACACTCTAGGATGAATAAAGATTTAGATCTTTCATTAAAATATTCACATGG
ATTCGTGTGCTATATTCAAAGTTTTATATTCTAGATAAAATTCTCCAATGTTATGTTCAA
TCAAACTTTTAATTATATTCTTGTTTTGATCATACCTTAATTGACTAACATTATCCCTTA
GGATTCTTGTAGGTTTTTTATTTTATGAGATTCCATGTGTGAATTTTCTAAGGTTTTCAG
TGTTTTTGTTTATATAGTCAAAAGCTACTGTTGGATATGTTGGACAAGCATTGCATTCAC
ATAAACGAAGCAATCACCGAGGAGCACAATAAACATGAGTCTCATCATCAGCCGTATTCT
T
   
Sequence Name 48-K023620-022-502-A02C-CC07
GenBank Accession LN506387 [GenBank]
Sequencing primer gene specific primer, CC07: 5'-CGAAATCATAAGAAGAATACGGCT-3'
Sequence (A. th genome BLAST matches underlined)
>48-K023620-022-502-A02C-CC07
GAGACTCATGTTTATTGTGCTCCTCGGTGATTGCTTCGTTTATGTGAATGCAATGCTTGT
CCAACATATCCAACAGTAGCTTTTGACTATATAAACAAAAACACTGAAAACCTTAGAAAA
TTCACACATGGAATCTCATAAAATAAAAAACCTACAAGAATCCTAAGGGATAATGTTAGT
CAATTAAGGTATGATCAAAACAAGAATATAATTAAAAGTTTGATTGAACATAACATTGGA
GAATTTTATCTAGAATATAAAACTTTGAATATAGCACACGAATCCATGTGAATATTTTAA
TGAAAGATCTAAATCTTTATTCATCCTAGAGTGTGCAAAAGCTTCGAACTTTAAATCCAT
ATAATTACTTTATTGAAGATTAGAAAGATTTAGTCTTTAGTTTCTTAGAGAATAATTGAA
AAACTTTCAAATATTATAATATACTAAATAAATTAGATTATAAAGCCCAACCTGTACTTG
TTTGGTATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TTTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16