SimpleSearch - Line and FST details


Line specific information

 
Line ID 502A02
Vector Used pAC161
Line Availability only available from NASC (N448098)
Segregation Analysis 50:47:29
Confirmed for Hit At3g26120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g26120

 
Sequence (A. th genome BLAST matches underlined)
>09-K019715-022-502-A02-8409
TGATCATGAGATTACCGGACATGAAGCCTTTACATTGAATATACCAACAAGTACAGGTTG
GGCTTTATAATCTAATTTATTTAGTATATTATAATATTTGAAAGTTTTTCAATTATTCTC
TAAGAAACTAAAGACTAAATCTTTCTAATCTTCAATAAAGTAATTATATGGATTTAAAGT
TCGAAGCTTTTGCACACTCTATGGGATCCTCCCTATAGTGAGACTATGGGATCCTCCCTA
TACCGAGGCTACGTGAATCTCCACATGCCGGGCTACCCTGACTTTATACCCCCCATTTTG
ACGTTGATGTAAACACAAAAAACGAACCATTCCCTTCCGCGAGTGCTATGAAAAAAGCAT
TTCAATTTATAATATCCCTAATTCAATCTATTTTATTTTCC
GenBank Accession BX533573 [GenBank]
Graphic View Graphic view of gene At3g26120
Predicted Position of Insertion Chr3:9547890 - go to primer design
BLAST e Value 6e-83
Hit Clone Code (BAC ID) MJL14
Hit Gene Code At3g26120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation terminal EAR1-like 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03