Sequences from confirmation amplicon


Confirmation sequences for line 511A08 and hit At1g17040 are shown.
Line ID 511A08
Locus At1g17040 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5827110
Primers used for PCR SD02 - 8474, show primer details
   
Sequence Name 01-K021970-022-511-A08C-8409
GenBank Accession LN486396 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K021970-022-511-A08C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATTGGTGGGAGCATCCGGAATAGAGA
GAAACTTGATCTGCAAATTCCGAGACTTCTTCGTCTGATGAATTGTTTGTGATTTCCTTC
AGAAGAAGAGCTCTCTCTGTTAAGTTTCCAAGGCAGTATTTGAAAATAATCCAGTCTGGG
ATTGAATATCTCCTGAAAGCAGTCGAGTCTCTCATTTCAGTGTTTTCGGAATCAGTTGAA
GAGTTATCTTCTTCGTGGTTCTGAGGCCTCCATTCCATACTCGTACCATTTCCATTCACA
ATCTAACTCGAGAGCAACAACAATGCAGAATAACAGTAAGTGGGATATGGATACAAAGCA
AAACAAAACGTAACTCAGAGAAATTGGATTATCCACCTTACTCTCAGAAACCTTTTCTTC
TCCTAATCTGATCCGTTTCATAGAGGAAACAGAATCACGGTTTCTCGAAATGCAACGGAT
TTGGTTGGTGACAGTTTCGAGGAAAGGATAATTGGCCTTCACTTCTGGTATTTCGAATTT
GATGCAGAACAACCTCTTATCACTCTTGGAAGAAAGCTACAAAACAAAAGAAAACAAGGA
TCCTTCAATGCCTTTTAGCATAGACAAAAAAATTCTAACAAGAATGTGAAATCCCATTCC
GAT
   
Sequence Name 02-K021970-022-511-A08C-SD02
GenBank Accession LN486851 [GenBank]
Sequencing primer gene specific primer, SD02: 5'-TTATAAATCTAGGCCATCGGAATG-3'
Sequence (A. th genome BLAST matches underlined)
>02-K021970-022-511-A08C-SD02
ACATTCTTGTTAGAATTTTTTTGTCTATGCTAAAAGGCATTGAAGGATCCTTGTTTTCTT
TTGTTTTGTAGCTTTCTTCCAAGAGTGATAAGAGGTTGTTCTGCATCAAATTCGAAATAC
CAGAAGTGAAGGCCAATTATCCTTTCCTCGAAACTGTCACCAACCAAATCCGTTGCATTT
CGAGAAACCGTGATTCTGTTTCCTCTATGAAACGGATCAGATTAGGAGAAGAAAAGGTTT
CTGAGAGTAAGGTGGATAATCCAATTTCTCTGAGTTACGTTTTGTTTTGCTTTGTATCCA
TATCCCACTTACTGTTATTCTGCATTGTTGTTGCTCTCGAGTTAGATTGTGAATGGAAAT
GGTACGAGTATGGAATGGAGGCCTCAGAACCACGAAGAAGATAACTCTTCAACTGATTCC
GAAAACACTGAAATGAGAGACTCGACTGCTTTCAGGAGATATTCAATCCCAGACTGGATT
ATTTTCAAATACTGCCTTGGAAACTTAACAGAGAGAGCTCTTCTTCTGAAGGAAATCACA
AAC
Primers used for PCR SD01 - 8474, show primer details
   
Sequence Name 17-K021971-022-511-A08C-8409
GenBank Accession LN493680 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K021971-022-511-A08C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATTGGTGGGAGCATCCGGAATAGAG
AGAAACTTGATCTGCAAATTCCGAGACTTCTTCGTCTGATGAATTGTTTGTGATTTCCTT
CAGAAGAAGAGCTCTCTCTGTTAAGTTTCCAAGGCAGTATTTGAAAATAATCCAGTCTGG
GATTGAATATCTCCTGAAAGCAGTCGAGTCTCTCATTTCAGTGTTTTCGGAATCAGTTGA
AGAGTTATCTTCTTCGTGGTTCTGAGGCCTCCATTCCATACTCGTACCATTTCCATTCAC
AATCTAACTCGAGAGCAACAACAATGCAGAATAACAGTAAGTGGGATATGGATACAAAGC
AAAACAAAACGTAACTCAGAGAAATTGGATTATCCACCTTACTCTCAGAAACCTTTTCTT
CTCCTAATCTGATCCGTTTCATAGAGGAAACAGAATCACGGTTTCTCGAAATGCAACGGA
TTTGGTTGGTGACAGTT
   
Sequence Name 18-K021971-022-511-A08C-SD01
GenBank Accession LN494128 [GenBank]
Sequencing primer gene specific primer, SD01: 5'-TCAAATTCGAAATACCAGAAGTGA-3'
Sequence (A. th genome BLAST matches underlined)
>18-K021971-022-511-A08C-SD01
AGCCAATTATCCTTTCCTCGAAACTGTCACCAACCAAATCCGTTGCATTTCGAGAAACCG
TGATTCTGTTTCCTCTATGAAACGGATCAGATTAGGAGAAGAAAAGGTTTCTGAGAGTAA
GGTGGATAATCCAATTTCTCTGAGTTACGTTTTGTTTTGCTTTGTATCCATATCCCACTT
ACTGTTATTCTGCATTGTTGTTGCTCTCGAGTTAGATTGTGAATGGAAATGGTACGAGTA
TGGAATGGAGGCCTCAGAACCACGAAGAAGATAACTCTTCAACTGATTCCGAAAACACTG
AAATGAGAGACTCGACTGCTTTCAGGAGATATTCAATCCCAGACTGGATTATTTTCAAAT
ACTGCCTTGGAAACTTAACAGAGAGAGCTCTTCTTCTGAAGGAAATCACAAACAATTCAT
CAGACGAAGAAGTCTCGGAATTTGCAGATCAAGTTTCTCTCTATTCCGGATGCTCCCACC
AATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAT
GGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGA
TGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCG
TCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATNTCGAC
GTGTCT

Last Updated on 23.10.2014 13:25