SimpleSearch - Line and FST details


Line specific information

 
Line ID 511A08
Vector Used pAC161
Line Availability only available from NASC (N448968)
Segregation Analysis 100:96:75
Confirmed for Hit At1g17040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g17040

 
Sequence (A. th genome BLAST matches underlined)
>57-K021274-022-511-A08-8409
TGGGATCCTCCCTATAGTGAGACAAATACCTATGGGATCCTCCCATATGTGAGAGAATTC
TAAACGCCTATTGGAAACTTCCCTATACTAAGAATTCTATGTCCCCCCACGCCATAGAGG
TCTCCCATTTCGGAGATTTCCCAAACAGTTGGAAATTTATCTTCTTCGCGCTTCTTAGGA
CTCCAATCTATACTCCTACCGTTATCCTTCCCAATCTAAGACGAGAGCAACAACAATGCA
AAATAACAGTAAGTGGGATATGGATACAAAGCAAAAAAAAACGTAACTCAAAGAAATTGG
ATTATCCACCTTACTCTCAGAAACCTTTTCTTCTCCTAATCTGATCCGTTTCAAAGAGGA
AACAAAATCTTGGTTTCTCGAAATGCAACGGATTTGCCTGGTAAGAGCTTATACGAAAAC
GTTCTTTGAAATCAAATCAAACAGATCTCTTCTTAT
GenBank Accession BX649829 [GenBank]
Graphic View Graphic view of gene At1g17040
Predicted Position of Insertion Chr1:5827107 - go to primer design
BLAST e Value 2e-69
Hit Clone Code (BAC ID) F6I1
Hit Gene Code At1g17040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SH2 domain protein A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX534640 [GenBank] BX649829 [GenBank]


Last Updated on 31.08.2016 09:40