Sequences from confirmation amplicon


Confirmation sequences for line 511G02 and hit At1g60030 are shown.
Line ID 511G02
Locus At1g60030 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22116301
Primers used for PCR UF14 - 8474, show primer details
   
Sequence Name 13-K021642-022-511-G02C-8409
GenBank Accession LN491844 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K021642-022-511-G02C-8409
AGCATCACTAAGTAATGCTGAAACCCCAAAAGTATTGCCTCCGCTGATCAGAAAAAAAAG
AAGTGATCTTTAGTTGTTAAATCAAAGATTACACATTGCACAAATGAAAGTATGAGAGAA
GATGGTTACGCCAAGGAGGAGGACTTGTGATGCAATAAGAGATAGAAGAAAGTTGATCTT
TCACCGGATGTGGCTCAAGCCCATCATGTTTTAGCGGCGGCGCTACCCCTCCTCCTCCTC
CACCACCACCGGCCATTTCCTTTAACTTCTGATGAAACCCAAAAGCAATTCAAGAGAAGA
AAAAACAGAGATAGGTTGAGTCTTTTGCTTGGAAT
   
Sequence Name 14-K021642-022-511-G02C-UF14
GenBank Accession LN492313 [GenBank]
Sequencing primer gene specific primer, UF14: 5'-AGATTCCAGCATAAAGACTCAACC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K021642-022-511-G02C-UF14
TGATTGCTTTTGGGTTTCATCAGAAGTTAAAGGAAATGGCCGGTGGTGGTGGAGGAGGAG
GAGGGGTAGCGCCGCCGCTAAAACATGATGGGCTTGAGCCACATCCGGTGAAAGATCAAC
TTTCTTCTATCTCTTATTGCATCACAAGTCCTCCTCCTTGGCGTAACCATCTTCTCTCAT
ACTTTCATTTGTGCAATGTGTAATCTTTGATTTAACAACTAAAGATCACTTCTTTTTTTT
CTGATCAGCGGAGGCAATACTTTTGGGGTTTCAGCATTACTTAGTGATGCTTGTAAATGG
CTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAA
AGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTA
TAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAA
AGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
Primers used for PCR UF13 - 8474, show primer details
   
Sequence Name 29-K021643-022-511-G02C-8409
GenBank Accession LN499106 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K021643-022-511-G02C-8409
TGAGCCATTTACATTGAATATATAGAAACTCTGTTTTTTTATCGGATTTGTATTCATTTG
TTGTAGGAAGAGAAGGCAAAGATGGTTCAGACATTACTTTTTGTTTCTGGACTTAATACT
TTATTGCAAAGTTTCTTTGGGACTAGACTTCCAGCGGTCATTGGAGGCTCTTACACCTAT
GTACCAACCACGCTTTCCATCATCTTGGCTGGTCGGTACAGCGACATTTTGGATCCTCAG
GAGGTTAGTTAAAGAAAAACAGAGCATCTATCTGTTTCTGTATCATATTTTCTCATTCAT
AGAGTGAAAATATGCAGAAATTTAAGAGGATCATGCGAGGAATCCAGGGTGCTCTTATCG
TTGCCTCGATTCTTCAGATCGTTGTTGGCTTCAGCGGGCTTTGGCGCAATGTAGTTAGGT
TAGCTAAGAACACTCAATCATATACAAAACACAACTAACAGATTCTCTTCTGCTATTTTC
TGATGATTGTTCTTACTTTCTTTAGGCTCCTGAGTCCTCTCTCTGCAGTTCCTCTAGTAG
CACTAGCT
   
Sequence Name 30-K021643-022-511-G02C-UF13
GenBank Accession LN499543 [GenBank]
Sequencing primer gene specific primer, UF13: 5'-ATAAAGTCCAAAACCAGCTAGTGC-3'
Sequence (A. th genome BLAST matches underlined)
>30-K021643-022-511-G02C-UF13
GAGCCTAAAGAAAGTAAGAACAATCATCAGAAAATAGCAGAAGAGAATCTGTTAGTTGTG
TTTTGTATATGATTGAGTGTTCTTAGCTAACCTAACTACATTGCGCCAAAGCCCGCTGAA
GCCAACAACGATCTGAAGAATCGAGGCAACGATAAGAGCACCCTGGATTCCTCGCATGAT
CCTCTTAAATTTCTGCATATTTTCACTCTATGAATGAGAAAATATGATACAGAAACAGAT
AGATGCTCTGTTTTTCTTTAACTAACCTCCTGAGGATCCAAAATGTCGCTGTACCGACCA
GCCAAGATGATGGAAAGCGTGGTTGGTACATAGGTGTAAGAGCCTCCAATGACCGCTGGA
AGTCTAGTCCCAAAGAAACTTTGCAATAAAGTATTAAGTCCAGAAACAAAAAGTAATGTC
TGAACCATCTTTGCCTTCTCTTCCTACAACAAATGAATACAAATCCGATAAAAAAACAGA
GTTTCTATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAA
AAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAAT
TACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTT
TATTTCGACGTGTCT

Last Updated on 07.07.2016 14:16