SimpleSearch - Line and FST details


Line specific information

 
Line ID 511G02
Vector Used pAC161
Line Availability only available from NASC (N449034)
Segregation Analysis 91:84:60
Confirmed for Hit At1g60030
Parent of DUPLO pair none
Parent of pair(s) 438, 5010, 5040, 5093, 5144, 10174, 73604, 73607

Gene hit At1g60030

 
Sequence (A. th genome BLAST matches underlined)
>15-K019928-022-511-G02-8409
TTTCCCGGACTGAAGCCATTTTACATTGAATATATAGAAACTCTGTTTTTTTATCGGATT
TGTATTCATTTGTTGTAGGAAGAGAAGGCAAAGATGGTTCAGACATTTACTTTTTGTTTC
TGGACTTAATACTTTATTGCAAAGTTTCTTTGGGACTATGGTATCCTCCCTATATGGAGG
CTCTTACACCTATGTACCAACCACTCTTTCCATCATCTTGGCTGGTCGGTACAGCGACAT
TTTGGATCCTCATGAGGTTAGTTAAAGAAAAACAGAGCATCTATCTGTTTCTGTATCATA
TTTTCTCATTCATAGAGTGAAAATATGCAGAAATTTAAGAGGATCATGCGAGGAATCCAG
GGTGCTCTTATCGTTGCCTCGATTCTTCAGATCGATGTTGGCTTCAGCGGGCTTTGGCGC
AATGTAGTTAGGTTAGCTAAGAACACTCAATCATATACAAAACACAACTAACAGATTCTC
TTCTGCTATTTTCTGATGATTGTTCTTACTTTCTTTAGGCTCCTGAGTCCTCTCTCTGCA
GTTCCTCTATGGGAT
GenBank Accession BX534726 [GenBank]
Graphic View Graphic view of gene At1g60030
Predicted Position of Insertion Chr1:22116301 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2K10
Hit Gene Code At1g60030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nucleobase-ascorbate transporter 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03