Sequences from confirmation amplicon


Confirmation sequences for line 512F03 and hit At2g34390 are shown.
Line ID 512F03
Locus At2g34390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14514552
Primers used for PCR RE68 - 8474, show primer details
   
Sequence Name 05-K027342-022-512-F03C-8409
GenBank Accession LN488209 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K027342-022-512-F03C-8409
AGCCATTTACAATTAGTTACAATGAGAGCAGCGAACAGATTTGAAGATGCTTGACCTTAA
AGATTGATCTACATCATCACAGAGGAAGATCGGTAACTCGTTTATGAGAAGATCCTGTCT
TGGAGAACTCAGGCTCTGCGTTCTGTATTGACGGTAACATTTTATGAATCAAGGCCCCAG
AGACGGCACCAAGTGTTGGAGCCAGCAAGTATATCCAAATCCCTTTGTAACATCCCCACA
CAAGTGCAGGTCCTATGCTTCTGGCTGGATTCATCGATGCTCCTGATACCTCTCTGTAAA
ATGAAAGTTTGGATTGTTCCCATTGGTTAGCCAAAAAGATTCTTACCATTGAAGAATTTT
AACTTGCAGAGATTGAGGGGGAAATGTGAAACTTACCCAGCAAATATAACATTCAGTGTG
ACGGTTGCCCCAATGATTAGCCCCTCTAGTTCCTCTGTCTGCAAGATTGATAAATGTTAA
GATTGAAATTTATATATATCATCTGATCATGAAGTGTTTTTGGTTGTTGATCGCTTACAG
TTCTCT
   
Sequence Name 06-K027342-022-512-F03C-RE68
GenBank Accession LN488661 [GenBank]
Sequencing primer gene specific primer, RE68: 5'-CACAACCACCAAGAGAACTGTAAG-3'
Sequence (A. th genome BLAST matches underlined)
>06-K027342-022-512-F03C-RE68
CTTCATGATCAGATGATATATATAAATTTCAATCTTAACATTTATCAATCTTGCAGACAG
AGGAACTAGAGGGGCTAATCATTGGGGCAACCGTCACACTGAATGTTATATTTGCTGGGT
AAGTTTCACATTTCCCCCTCAATCTCTGCAAGTTAAAATTCTTCAATGGTAAGAATCTTT
TTGGCTAACCAATGGGAACAATCCAAACTTTCATTTTACAGAGAGGTATCAGGAGCATCG
ATGAATCCAGCCAGAAGCATAGGACCTGCACTTGTGTGGGGATGTTACAAAGGGATTTGG
ATATACTTGCTGGCTCCAACACTTGGTGCCGTCTCTGGGGCCTTGATTCATAAAATGTTA
CCGTCAATACAGAACGCAGAGCCTGAGTTCTCCAAGACAGGATCTTCTCATAAACGAGTT
ACCGATCTTCCTCTGTGATGATGTAGATCAATCTTTAAGGTCAAGCATCTTCAAATCTGT
TCGCTGCTCTCATTGTAACTAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACG
ACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGA
AATCTTTATTTCGACGTGTCTA

Last Updated on 07.07.2016 14:16