SimpleSearch - Line and FST details


Line specific information

 
Line ID 512F03
Vector Used pAC161
Line Availability only available from NASC (N449119)
Segregation Analysis 50:49:48
Confirmed for Hit At2g34390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34390

 
Sequence (A. th genome BLAST matches underlined)
>22-K019922-022-512-F03-8409
GATAATCTATTACTGTAACTATCATGTTTTGTACGTTGGTAAAACAGACGAAATTTGTGG
TAATCATCAGTCATGTTTGACTTTTACCCATTTTGACCTATGGGATCTTCCCTATAGTGA
GAGGAAGATGCCGCTCTTGTAAACACACGGTCATCACTATTTCTTGTCGAAGAGCATATT
CTGAGTCACAGCACCAGAGACTGCTGCTACTGCTACAATGAGATCCTTATTCCAATCCCT
TTGGAACATCCCCACACAAGTGCAGGTCCTATGCTTCTGGCTGGATTCATCGATGCTCCT
GATACCTCTCTGTAAAATGAAAGTTTGGATTGTTCCCATTGGTTAGCCAAAAAGATTCTT
ACCATTGAAGAATTTTAACTTGCAGAGATTGAGGGGGAAATGTGAAACTTACCCAGCAAA
TATAACATTCAGTGTGACGGTTGCCCCAATGATTAGCCCCCCTATGGGA
GenBank Accession BX534835 [GenBank]
Graphic View Graphic view of gene At2g34390
Predicted Position of Insertion Chr2:14514574 - go to primer design
BLAST e Value 7e-123
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NOD26-like intrinsic protein 2;1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX534836 [GenBank]


Last Updated on 31.08.2016 09:40