Sequences from confirmation amplicon


Confirmation sequences for line 516B03 and hit At3g14030 are shown.
Line ID 516B03
Locus At3g14030 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4646734
Primers used for PCR NG54 - 8474, show primer details
   
Sequence Name 48-K102366-0022-516-B03C-8409
GenBank Accession LN506469 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>48-K102366-0022-516-B03C-8409
ATTTACAATTGAATATCAAAACAGAGTAGAAAAACTGGAAGATACGTTGTATCTACGTCG
ACCTCTTCCATTCCTTCTCCTTCCACCGTTGCTTTTTCTTGAGCGTAAAAGTAAGTATTT
CCCTTCAAAGATACGCCGCGTTGATTAAACACTATCTCCCAGTCGGGAGTGACATCAAGA
ACACTCCATGAATCAGAGCTAAGATGGTAGATTTCAAACCCAAAAACTTTGTTTCGAAAG
TGAGGTAATCATTCACAAACCTCAAGATTTTGTGGTTACGAGGTTGTTGTCGTATCCAAG
AGCATACGTCTAGTCTATGGAAATTGTTTTTGGGTTGGATCCATCTCGTTTGTCCCAAAC
AAGGATTCCATACAACTG
   
Sequence Name 48-K102367-0022-516-B03C-NG54
GenBank Accession LN506470 [GenBank]
Sequencing primer gene specific primer, NG54: 5'-TCAGTTGTATGGAATCCTTGTTTG-3'
Sequence (A. th genome BLAST matches underlined)
>48-K102367-0022-516-B03C-NG54
CATTTCCTAGACTAGACGTATGCTCTTGGATACGACAACAACCTCGTAACCACAAAATCT
TGAGGTTTGTGAATGATTACCTCACTTTCGAAACAAAGTTTTTGGGTTTGAAATCTACCA
TCTTAGCTCTGATTCATGGAGTGTTCTTGATGTCACTCCCGACTGGGAGATAGTGTTTAA
TCAACGCGGCGTATCTTTGAAGGGAAATACTTACTTTTACGCTCAAGAAAAAGCAACGGT
GGAAGGAGAAGGAATGGAAGAGGTCGACGTAGATACAACGTATCTTCCAGTTTTTCTACT
CTGTTTTGATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATA

Last Updated on 07.07.2016 14:16