SimpleSearch - Line and FST details


Line specific information

 
Line ID 516B03
Vector Used pAC161
Line Availability only available from NASC (N449455)
Segregation Analysis 50:31:27
Confirmed for Hit At3g14030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g14030

 
Sequence (A. th genome BLAST matches underlined)
>18-K019946-022-516-B03-8409
TGATCTGANATTTCCCGGACATGAAGCCATTTACAATTGAATATCAAAACAGAGTAGAAA
AACTGGAAGATACGTTGTATCTACGTCGACCTCTTCCATTCCTTCTCCTTCCACCGTTGC
TTTTTCTTGAGCGTAAAAGTAAGTATTTCCCTTCAAAGATACGCCGCGTTGATTAAACAC
TATCTCCCAGTCGGGAGTGACATCAAGAACACTCCATGAATCAGAGCTAAGATGGTAGAT
TTCAAACCCAAAAACTTTGTTTCGAAAGTGAGGTAATCATTCACAAACCTCAAGATTTTG
TGGTTACGAGGTTGTTGTCGTATCCAAGAGCATACGCCTATGGGATCCTCCCCCTATATA
GTGAGACTATGGGATCCTCCCGATAGTGGGCTACACTGAATTGGTAGCTCCCATTTGGAC
GTGAATGTAGACACTATGAGATCCCATTTTCTGGAGAGAGAGTAATTTGTTTATTGCTTT
CGCCTATAAATACAACGGATCGTAATTTGTCGCTTTATCAAAATGGACTTTTCTTTTATA
ATAACCGCTGGGGACATCTTAATTTTTGAATCTGAAAAAAAGGGGGAATGAACCCGTCCT
TTCTCACGCGGTGGACCAAGAATGATCGATTGGTGACGGAAGAGAGACTCGCCGAGAGTT
CAAAACCTATGCAATGGGGGAGTCAAAAAAGGAAACGAGATGCTGGGAGAGACCCCTGTA
ACCCCCGCCGGCTGCCCCACTCTAAAAAATACCAACCCTCACCGCCCCTACATATACACA
CCCCGTCCGTATAATATCGCGCGCCCGCCCAGTCCCAATTATCAGGTACTGTCCATCAAC
AAAAGTATTGTGATGTAACTCCAAGTATAATACGGGCCC
GenBank Accession BX535255 [GenBank]
Graphic View Graphic view of gene At3g14030
Predicted Position of Insertion Chr3:4646734 - go to primer design
BLAST e Value 3e-165
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box associated ubiquitination effector family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03