Sequences from confirmation amplicon


Confirmation sequences for line 520G10 and hit At3g55320 are shown.
Line ID 520G10
Locus At3g55320 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20510082
Primers used for PCR NG50 - 8474, show primer details
   
Sequence Name 50-K102368-0022-520-G10C-8409
GenBank Accession LN507119 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>50-K102368-0022-520-G10C-8409
ATTTACACGACTTAATTGTTAAGTTCTAAGCTATCATACCTTCTTGGAAGCTTTGTTGCT
TCTTCACACTTCAGAAGCTCAGCATACAGCCCACCAAGATTTATCAATTCATCGTGTGTA
CCCATTTCAACGAGCTGACCCTCCTCCATCACAGCAATATAGTCAGCATTTTTTATCAAA
CTTAATCGTCGGGCTATTATTATGGTTGACCGTCCCAACATCAGAAGATCAAGAGCTTCC
TGCACAATTCTTTCAGCTTCGAAGTCTAGTCCTCCAGTTACTTCATCAAGCAGAAGAATT
GTTGGATTCAAAAGCACAGCTCTAGCAATCGAAAGTTTAATTTTCTGCTCCTCTGTCATT
GCTAAACCGGCTCTCCCGACCTAGAAGAAAAACAAGGCATTTCCCACTTCAATGTTGAAT
AATCAACTGACAAAACAAGATTTCAG
   
Sequence Name 50-K102369-0022-520-G10C-NG50
GenBank Accession LN507120 [GenBank]
Sequencing primer gene specific primer, NG50: 5'-TCTGAAATCCTGTTTTGTCAGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>50-K102369-0022-520-G10C-NG50
ATGCCTTGTTTTTCTTCTGGTCGGGAGAGCCGGTTTAGCAATGACAGAGGAGCAGAAAAT
TAAACTTTCGATTGCTAGAGCTGTGCTTTTGAATCCAACAATTCTTCTGCTTGATGAAGT
AACTGGAGGACTAGACTTCGAAGCTGAAAGAATTGTGCAGGAAGCTCTTGATCTTCTGAT
GTTGGGACGGTCAACCATAATAATAGCCCGACGATTAAGTTTGATAAAAAATGCTGACTA
TATTGCTGTGATGGAGGAGGGTCAGCTCGTTGAAATGGGTACACACGATGAATTGATAAA
TCTTGGTGGGCTGTATGCTGAGCTTCTGAAGTGTGAAGAAGCAACAAAGCTTCCAAGAAG
GTATGATAGCTTAGAACTTAACAATTAAGTCGTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGAGGGTCAATA

Last Updated on 23.10.2014 13:25