SimpleSearch - Line and FST details


Line specific information

 
Line ID 520G10
Vector Used pAC161
Line Availability only available from NASC (N449906)
Segregation Analysis 50:44:41
Confirmed for Hit At3g55320
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g55320

 
Sequence (A. th genome BLAST matches underlined)
>79-K020203-022-520-G10-8409
GGAAGCTTCGTTGCTTCTTCACACTTCAGAAGCTCAGCATACAGCCCACCAAGATTTATC
AATTCATCGTGTGTACCCATTTCAACGAGCTGACCCTCCTCCATCACAGCAATATAGTCA
GCATTTTTTATCAAACTTAATCGTCGGGCTATTATTATGGTTGACCGTCCCAACATCAGA
AGATCAAGAGCTTCCTGCACAATTCTTTCAGCTTCGAAGTCTATTCCTCCATTTACTTCA
TCAGGCAGAAGAATTGTTGGATTCAAAAGCACAGCTCTATGGGATCCTCNCTATAGTGAG
ACTATGGGATCCTCCCTATTGTGGGCTACNCTCAATTGGNANCGCTTTGGGATCCTCTCT
ATAGTGAGAACTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX535733 [GenBank]
Graphic View Graphic view of gene At3g55320
Predicted Position of Insertion Chr3:20510099 - go to primer design
BLAST e Value 5e-147
Hit Clone Code (BAC ID) T26I12
Hit Gene Code At3g55320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-glycoprotein 20
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX535733 [GenBank]


Last Updated on 31.08.2016 09:40