Sequences from confirmation amplicon


Confirmation sequences for line 521D08 and hit At1g73325 are shown.
Line ID 521D08
Locus At1g73325 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:27567880
Primers used for PCR NG48 - 8474, show primer details
   
Sequence Name 51-K102368-0022-521-D08C-8409
GenBank Accession LN507456 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>51-K102368-0022-521-D08C-8409
CGGACTGAGCCATTTACAATTGAATTATCCGAACTGCTTGACTTTGGTGTTTAGTGGGGA
GAATGTTACGGGAAGGCCTGAGACGAAAGGAGATGATGATTGGACAATGTCAAGATTCAG
ACACAAGTCTTGTGTGCTTAAATTTCGGTTTGAAGGGATAAGACCACCTCCGGTTCCGAT
CTTGGCCGGTATGATGTAGTATTGGACATTGGACTGAACCGGATGTCCAGCTATGTCTAG
GACTACTTGGCTTGGTGTAGCATCGGCCGCTGAAGCTGCGGTGAAGATGGCTGAGAGAAC
GGTGAGAGTGATGAAAGACAAAGTAAGCTTCTCCATAGTTTGAAAATTGTTTCGTGGTG
   
Sequence Name 51-K102369-0022-521-D08C-NG48
GenBank Accession LN507457 [GenBank]
Sequencing primer gene specific primer, NG48: 5'-CACCACGAAACAATTTTCAAACTA-3'
Sequence (A. th genome BLAST matches underlined)
>51-K102369-0022-521-D08C-NG48
TCTCACGTTCTCTCAGCCATCTTCCCGCAGCTTCAGCGGCCGATGCTACACCAAGCCAAG
TAGTCCTAGACATAGCTGGACATCCGGTTCAGTCCAATGTCCAATACTACATCATACCGG
CCAAGATCGGAACCGGAGGTGGTCTTATCCCTTCAAACCGAAATTTAAGCACACAAGACT
TGTGTCTGAATCTTGACATTGTCCAATCATCATCTCCTTTCGTCTCAGGCCTTCCCGTAA
CATTCTCCCCACTAAACACCAAAGTCAAGCATGTTCGGATAAATTCAATTGTAAATGGCT
TCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGACAATATAG

Last Updated on 07.07.2016 14:16