SimpleSearch - Line and FST details


Line specific information

 
Line ID 521D08
Vector Used pAC161
Line Availability only available from NASC (N449964)
Segregation Analysis 50:46:34
Confirmed for Hit At1g73325
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g73325

 
Sequence (A. th genome BLAST matches underlined)
>60-K020048-022-521-D08-8409
TTTACATTGAATTTATCCGAACATGCTTGACTTTGGTGTTTAGTGGGGAGAATGTTACGG
GAAGGCCTGAGACGAAAGGAGATGATGATTGGACAATGTCAAGATTCAGACACAAGTCTT
GTGTGCTTAAATTTCGGTTTGAAGGGATAAGACCACCTCCGGTTCCGATCTTGGCCGGTA
TGATGTAGTATTGGACATTGGACTGAACCGGATGTCCAGCTATGCCTATGGGATCCTCCC
TATAGTGAGANNNNNNNNN
GenBank Accession BX535797 [GenBank]
Graphic View Graphic view of gene At1g73325
Predicted Position of Insertion Chr1:27567880 - go to primer design
BLAST e Value 3e-113
Hit Clone Code (BAC ID) T9L24
Hit Gene Code At1g73325 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Kunitz family trypsin and protease inhibitor protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23