Sequences from confirmation amplicon


Confirmation sequences for line 521E09 and hit At2g31085 are shown.
Line ID 521E09
Locus At2g31085 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13253980
Primers used for PCR PW17 - 8474, show primer details
   
Sequence Name 43-K024604-022-521-E09C-8409
GenBank Accession LN504705 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K024604-022-521-E09C-8409
GTAGATTCCCGGACATGAAGCCATTTACAATTGAATATATGATGAGTTTCTCTTTTCAAC
TCATGCATGAGTTTTATAATCCAAAATATGCGTAGGATTCGGCTTTCATTAATTTCTGTT
GTGGATCCCATCATGTTCTCTCCACTGGCCCAAACTATATCCTTAACCTGTTCCCGTTTT
ATGTTTGTGTCTTTAATTATCTATAAATAGAAAATCTCAACACATACAAGTCATCATACT
CTCTCAACTTCATCTCTCTCTCTCTCTCAATCTCTTAAGATCCCACAAGTCACTTTTCTT
CTTCTTAATCACCTTTAATGGCGAATTTGATCCTTAAGCAATCTCTAATCATACTCCTAA
TCATATATTCAACACCAATCTTGAGTTCTCAAGCTCGAATCCTCCGTACATATCGCCCCA
CAACCATGGGCGATATGGATAGTCAGGTTCTCCTACGTGAACTCGGGATTGATCTCTCTA
AGTTCAAAGGTCAAGACGAGAGACGGTTTTTAGTGGATTCCGAAAGGGTTTCTCCGGGGG
GTCCTGATCCACAACACCATTGACTGATCTTTACCGATATATATATACTTTACCGAAGAT
CGAAGCACACATATAACTGTGACTGATCCATGCAAGTCAATTTAAATATCGTCATTTAC
   
Sequence Name 44-K024604-022-521-E09C-PW17
GenBank Accession LN505050 [GenBank]
Sequencing primer gene specific primer, PW17: 5'-ATCTTGTTGGTTTCCCTACAAATG-3'
Sequence (A. th genome BLAST matches underlined)
>44-K024604-022-521-E09C-PW17
AGGTAAAACTTAAACGATAAAGACAGGGGAAATAGCCAATCGCTGTTACAAAAAAGGTAA
CTCATTGGAGACACAAGAAAACATAGAGAGTAAAACCTTGATGTTTAAAGATAAGGAAGG
TACAAGAATACCAAAATCTTGATACAACAAAAGTGTAGGGAAGATTTATGAAAAAGAAAA
GAAAAGCATGTAAATGACGATATTTAAATTGACTTGCATGGATCAGTCACAGTTATATGT
GTGCTTCGATCTTCGGTAAAGTATATATATATCGGTAAAGATCAGTCAATGGTGTTGTGG
ATCAGGACCCCCCGGAGAAACCCTTTCGGAATCCACTAAAAACCGTCTCTCGTCTTGACC
TTTGAACTTAGAGAGATCAATCCCGAGTTCACGTAGGAGAACCTGACTATCCATATCGCC
CATGGTTGTGGGGCGATATGTACGGAGGATTCGAGCTTGAGAACTCAAGATTGGTGTTGA
ATATATGATTAGGAGTATGATTAGAGATTGCTTAAGGATCAAATTCGCCATTAAAGGTGA
TTAAGAAGAAGAAAAGTGACTTGTGGGATCTTAAGAGATTGAGAGAGAGAGAGAGATGAA
GTTGAGAGAGTATGATGACTTGTATGTGTTGAGATTTTCTATTTATAGATNATTAAAGAC
ACAAACATAAAACGGG

Last Updated on 07.07.2016 14:16