SimpleSearch - Line and FST details


Line specific information

 
Line ID 521E09
Vector Used pAC161
Line Availability only available from NASC (N449977)
Segregation Analysis 50:44:35
Confirmed for Hit At2g31085
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31085

 
Sequence (A. th genome BLAST matches underlined)
>69-K020048-022-521-E09-8409
GATATGGGTTATTTGAATTGACCTTCTTATTTTTTTGGTCAAAATTTAGTTGACCCTTAA
CGATCGAAATTCTCAGGTGGAAATCTATATTTCAGGGACCAGTAGTAAGTAACTTTATAT
CCATATTTAATTAAGAATTAGTCATAAGGATCACTATGGGACCCTCCCTATACTGAGCAT
CATACTCTCTCATCTTCATCTCTCTCTCTCACTCTATCTCTTAAGATCCCAAAAGTCACT
TTTCTTCTGCGTACTCACTTTTAATGGCGAATTTGATCCGTAAGCAATCTCTAAGGATAC
TCCTAATCATATATACGACACCAATCTTGAGGTCTCAAGCTCGAATCCTCCGTACATATC
GCCCCACAACCATGGGCGATATGGATAGTCAGGTTCTCCTACGTGAACTCGGGATTGATC
TCTCTAAGTTCAAAGGTCAAGACGAGAGACGGTTTTTAGTGGATTCCGAAAGGGTTTCTC
CGGGGGGTCCTGATCCACAACACCATTGACTGATCTTTACCGATATATATATACTTTACC
GAAGATCGAAGCACACATATAACTGTGACTGATCCATGCAAGTCAATTTAAATATCGTCA
TTTACATGCTTTTCTTTTCTTTTTCATAAATCTTCCCTACACTTTTGTTGTATCAAGATT
TTGGTATTCTTGTACCTTCCTTATCTTTAAACATCAAGGTTTTACTCTCTATGTTTTCTT
GTGTCTCCAATGAGTTACCTTTTTTGTAACAGCGATTGGCTATTTCCCCTGTCTATATCG
TTTAAGTTTTACCTTTTCATGTGTAGGGAAACCAACAAGATAGACCCTATGGGAT
GenBank Accession BX535819 [GenBank]
Graphic View Graphic view of gene At2g31085
Predicted Position of Insertion Chr2:13253998 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T16B12
Hit Gene Code At2g31085 [TAIR] [MIPS] [SIGnAL]
Gene Annotation CLAVATA3/ESR-RELATED 6
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX535820 [GenBank]


Last Updated on 14.10.2014 10:23