Sequences from confirmation amplicon


Confirmation sequences for line 522C03 and hit At1g76930 are shown.
Line ID 522C03
Locus At1g76930 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:28896829
Primers used for PCR PN06 - 8474, show primer details
   
Sequence Name 43-K022563-022-522-C03C-8409
GenBank Accession LN504698 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K022563-022-522-C03C-8409
ATTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGAAAGAGGCCATTGGTGCCC
CCATTGTGTTATGTGTTTTGCTTTGTGTTTGATGCTCTTACTCTCTCCCGTTAGCATCCT
TTATATAGCTTCTCACATTTACATTTTATCCCTTTTTACGACTATCTCTCATGGTAGTAA
ATTTGTGTCCTGTTGTGTGTAAGCAATACAAAAAAAGACATTGACTATATTAATAATACA
AAGAAAGAAAATGAGGTTAGTCTCCCTCGCTCGGGTTTCATTATTGATTCTCTTCTTCCC
TTCTATTATTTTCGGTCGTAGTTGATCGACATGTTCTGAATGTTCCGAACGTATAAAATC
ACATATAATATAGAGAACATTGAATCTAAAGATAACAGGATTATACCAAAAAAGAAGAAG
AAGAAAACAAAAATCTAAAGCTAACAGAATTTAAGTATGAAATATGTTAACCAAACAAAA
CTACAAGAATTGATCGAGAGGTAGATCGGCCTGAAGAAAGATCATATGAGAGGATAATAC
ATCCATTTCTGAGTATGGTAAATGTTAACAGTTACTTCATTTAACAGCACATGAAATTCT
AGA
   
Sequence Name 44-K022563-022-522-C03C-PN06
GenBank Accession LN505046 [GenBank]
Sequencing primer gene specific primer, PN06: 5'-CATATGGCCTCGTTTCTAGAATTT-3'
Sequence (A. th genome BLAST matches underlined)
>44-K022563-022-522-C03C-PN06
GGCCATGTGCTGTTAAATGAAGTAACTGTTAACATTTACCATACTCAGAAATGGATGTAT
TATCCTCTCATATGATCTTTCTTCAGGCCGATCTACCTCTCGATCAATTCTTGTAGTTTT
GTTTGGTTAACATATTTCATACTTAAATTCTGTTAGCTTTAGATTTTTGTTTTCTTCTTC
TTCTTTTTTGGTATAATCCTGTTATCTTTAGATTCAATGTTCTCTATATTATATGTGATT
TTATACGTTCGGAACATTCAGAACATGTCGATCAACTACGACCGAAAATAATAGAAGGGA
AGAAGAGAATCAATAATGAAACCCGAGCGAGGGAGACTAACCTCATTTTCTTTCTTTGTA
TTATTAATATAGTCAATGTCTTTTTTTGTATTGCTTACACACAACAGGACACAAATTTAC
TACCATGAGAGATAGTCGTAAAAAGGGATAAAATGTAAATGTGAGAAGCTATATAAAGGA
TGCTAACGGGAGAGAGTAAGAGCATCAAACACAAAGCAAAACACATAACACAATGGGGGC
ACCAATGGCCTCTTTCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATNGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATT
Primers used for PCR FN23 - 8474, show primer details
   
Sequence Name 63-K032008-022-522-C03C-8409
GenBank Accession LN510910 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>63-K032008-022-522-C03C-8409
CCATTTACAATTGAATATATCCATGCAAACCACCGCAAATTACTTCTACTCTTCCCCTCC
ACCACCGGTTAAGCATTACTCTCCTCCTCCTGTTTACAAGTCCCCACCACCACCGGTTAA
GCACTACTCGCCTCCTCCCGTTTACAAGTCCCCACCACCACCGGTTAAGCACTACTCGCC
TCCTCCGGTTTACAAGTCTCCCCCACCACCGGTTAAATACTACTCCCCTCCTCCGATTTA
CAAGTCTCCCCCACCACCGGTTAAATACTACTCCCCTCCTCCGGTTTACTAGTCCCCCCC
ACCACCGGTTAAAAAGTACTCCCCCCCACCGGTTTACAACTACACCCCACCACCGGTTAA
GTAGTACTCCCCTCCTCCGGTTTAGAAGTATTCCACTCCTCCGGTTAAAAAGTATTCCCC
TCCTCCGGTTGAGTAGATTTACAAGTCTCCCCCACCACCGGTTAAGTACTACTCCCCTCC
TCCGGTTAACAAGTCTCCCCCACCACCGGTTAACTAGTACTCCCCTCCTCCGGTTAAAAA
GTACTCCCCTCCACCGGTTAAAAATTATTCCCCTCCACCGGTTAAAAAGTCTTCCCCTCC
TCCGGTTA
   
Sequence Name 64-K032008-022-522-C03C-FN23
GenBank Accession LN511123 [GenBank]
Sequencing primer gene specific primer, FN23: 5'-CGGAGGAGGGGAGTAGTATTTAAC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K032008-022-522-C03C-FN23
TGCTTAACCGGTGGTGGTGGGGACTTGTAAACGGGAGGAGGCGAGTAGTGCTTAACCGGT
GGTGGTGGGGACTTGTAAACAGGAGGAGGAGAGTAATGCTTAACCGGTGGTGGAGGGGAA
GAGTAGAAGTAATTTGCGGTGGTTTGCATGGATATATTCAATTGTAAATGGCTTCATGTC
CGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGT
AATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAA
AGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAA
CAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGG

Last Updated on 07.07.2016 14:16