SimpleSearch - Line and FST details


Line specific information

 
Line ID 522C03
Vector Used pAC161
Line Availability only available from NASC (N450043)
Segregation Analysis 97:80:74
Confirmed for Hit At1g76930
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g76930

 
Sequence (A. th genome BLAST matches underlined)
>19-K020204-022-522-C03-8409
GAGCCACCATTGTGGGATGTGTTTCGCTTGGTGTTTGATGCTCTTGAGCTCTCCCGTTAG
CATCCTTTATATAGCTTCTCACATTTACATTTTATCCCTTTTTACGACTATCTCTCATGG
TAGTATATTTGTGTCCTGTTGTGTGTAAGCAATACAAAAAAAGACATTGACTATATTAAT
AATACAAAGAAAGAAAATGAGGTTAGTCTCCCTCGCTCGGGTTTCATTATTGATTCTCTT
CTTCCCTTCTATTATTTTCGGTCGTAGTTGATCGACATGTTCTGAATGTTCCGAACGTAT
AAAATCACATATAATATAGAGAACATTGAATCTAAAGATAACAGGATTATACCAAAAAAG
AAGAAGAAGAAAACAAAAATCTAAAGCTAACAGAATTTAAGTATGAAATATGTTAACCAA
ACAAAACTACAAGAATTGATCGAGAGGTAGATCGGCCTGAAGAAAGATCATATGAGAGGA
TAATACATCCATTTCTGA
GenBank Accession BX535916 [GenBank]
Graphic View Graphic view of gene At1g76930
Predicted Position of Insertion Chr1:28896829 - go to primer design
BLAST e Value 2e-165
Hit Clone Code (BAC ID) F22K20
Hit Gene Code At1g76930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation extensin 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG969017 [GenBank] BX535915 [GenBank]


Last Updated on 07.07.2016 14:03