Sequences from confirmation amplicon


Confirmation sequences for line 523C11 and hit At4g28350 are shown.
Line ID 523C11
Locus At4g28350 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:14026588
Primers used for PCR NG45 - 8474, show primer details
   
Sequence Name 73-K102370-0022-523-C11C-8409
GenBank Accession LN512870 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>73-K102370-0022-523-C11C-8409
CATTTACAGAAGAGCTTTGTCAAAGAGATTTGATTGGTTTGTTCTCGATTCAACGAACCG
ATTGTTCAAATATATTGTCTGAAACTGGAAAGATCTGTTCCAGAGTCAAAATTATTAAGG
AGATAATGTTGTTTAATGTATATATGCTAATTATATGTGTTAGAAATCTGTTTGAACAAC
AAATGTGGACGAAATAATATCCGCCGTGATAATTTGATCTCTCGTTTATTTATTTTCCTA
AGCATTTGGAATTTTGTTTTTGTATATTTCTTGATCCAAGCCACTTGGAATTAATCGTGA
AATTGTTGGACTTGGTATTTCGCTGTCCACATTTATAGGTGTGAATAATGATGAACTTAT
TCGTCAAAAAAGTCAGCTTTGAAATGTCAAATATTCATCTTCTTCTTGATTCTCCTCTTT
AATTCTTTCAAACATATCGCACATAACTCAAATTATTCGTCACCTGTAAGCATCATAGTA
TTAATAGGACCTAGTATATATTAATCCTAAAATCATCATGTCAAAGGCCTAAC
   
Sequence Name 73-K102371-0022-523-C11C-NG45
GenBank Accession LN512871 [GenBank]
Sequencing primer gene specific primer, NG45: 5'-TGTTAGGCATTTGACATGATGATT-3'
Sequence (A. th genome BLAST matches underlined)
>73-K102371-0022-523-C11C-NG45
TGATGCTTACAGGTGACGAATAATTTGAGTTATGTGCGATATGTTTGAAAGAATTAAAGA
GGAGAATCAAGAAGAAGATGAATATTTGACATTTCAAAGCTGACTTTTTTGACGAATAAG
TTCATCATTATTCACACCTATAAATGTGGACAGCGAAATACCAAGTCCAACAATTTCACG
ATTAATTCCAAGTGGCTTGGATCAAGAAATATACAAAAACAAAATTCCAAATGCTTAGGA
AAATAAATAAACGAGAGATCAAATTATCACGGCGGATATTATTTCGTCCACATTTGTTGT
TCAAACAGATTTCTAACACATATAATTAGCATATATACATTAAACAACATTATCTCCTTA
ATAATTTTGACTCTGGAACAGATCTTTCCAGTTTCAGACAATATATTTGAACAATCGGTT
CGTTGAATCGAGAACAAACCAATCAAATCTCTTTTGACAAAGCTCTTCTTGTAAATGGCT
TCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAGGGTCAATATA
Primers used for PCR NG46 - 8474, show primer details
   
Sequence Name 74-K102370-0022-523-C11C-OriL
GenBank Accession LN513045 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>74-K102370-0022-523-C11C-OriL
AGTTTCATTCTTCTCTTTTCCCTCGCATCCCTACTCTTGTTCCGATCAACCACAGGCATC
GAATTCATCTACAACTCCAATTTCACCACAACCAACACACTTCTCCTCGGCAACGCCACT
GTTAAATCTCCACCGTCGATCCTCACCCTCACCAACCAAACCACTTTCTCCATCGGACGT
GGCCTCTACCCTTCAAGAATCAACGCCTCCTCCTCCTCTGCCTCGCCGTTACCTTTCGCC
ACATCATTCATCTTCTCCATGGCTCCTTTTAAACACCTCTCTCCTGGCCACGGCTTCGCC
TTCGTCTTCCTTCCTTTCTCCGAAACCTCCGCCGCAAGCTCATCTCAGCATCTCGGCCTC
TTCAACTTCACCAATAACGGTGACCCCAATAGCCGAATCTTCGCCGTTGAATTCGATGTT
TTCGCTAACCAAGAGTTCAACGACATC
   
Sequence Name 74-K102371-0022-523-C11C-NG46
GenBank Accession LN513046 [GenBank]
Sequencing primer gene specific primer, NG46: 5'-TGATGTCGTTGAACTCTTGGTTAG-3'
Sequence (A. th genome BLAST matches underlined)
>74-K102371-0022-523-C11C-NG46
GGCTTTGGGGTCACCGTTATTGGTGAAGTTGAAGAGGCCGAGATGCTGAGATGAGCTTGC
GGCGGAGGTTTCGGAGAAAGGAAGGAAGACGAAGGCGAAGCCGTGGCCAGGAGAGAGGTG
TTTAAAAGGAGCCATGGAGAAGATGAATGATGTGGCGAAAGGTAACGGCGAGGCAGAGGA
GGAGGAGGCGTTGATTCTTGAAGGGTAGAGGCCACGTCCGATGGAGAAAGTGGTTTGGTT
GGTGAGGGTGAGGATCGACGGTGGAGATTTAACAGTGGCGTTGCCGAGGAGAAGTGTGTT
GGTTGTGGTGAAATTGGAGTTGTAGATGAATTCGATGCCTGTGGTTGATCGGAACAAGAG
TAGGGATGCGAGGGAAAAGAGAAGAATGGAAACTTTAGAGAAATCTACATGGATCAGCAA
TAAGTATGATGGTCAATA

Last Updated on 23.10.2014 13:25