Sequences from confirmation amplicon


Confirmation sequences for line 537D02 and hit At5g58380 are shown.
Line ID 537D02
Locus At5g58380 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:23597930
Primers used for PCR RE16 - 8474, show primer details
   
Sequence Name 05-K025300-022-537-D02C-8409
GenBank Accession LN488197 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K025300-022-537-D02C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTTATTTTTGTTTGTCCTATTG
GCAGGCTATCTACCTTTCCATGACTCCAATCTGATGGAGATGTACAGGAAGATAGGAAAA
GCAGATTTTAAGGCACCAAGCTGGTTTGCTCCAGAAGTACGGAGGCTGTTGTGTAAGATG
CTAGACCCTAACCCTGAAACTAGAATCACCATCGCAAGAATCAGGGAGAGTTCTTGGTTC
AGAAAAGGTTTACATATGAAACAGAAAAAGATGGAGAAACGAGTCAAAGAGATAAACTCT
GTGGAAGCTGGTACTGCAGGTACAAATGAGAACGGAGCAGGTCCAAGTGAGAATGGAGCA
GGTCCAAGTGAAAACGGAGACAGGGTCACGGAGGAAAACCATACAGACGAACCTACAAAT
TTGAACGCTTTTGATTTAATTGCCTTGTCTGCTGGGTTTGATCTGGCAGGACTGTTTGGA
GATGATAACAAGAGAGAATCTAGATTCACATCACAGAAACCTGCTTCAGTGATCATATCT
AAGCTGGAGGAAGTAGCACAGCGATTGAAACTGAGCATAAGAAAGCGAGAAGCAGGTTTG
TTCAAATTGGAACGATTAAAAGAAGGAAG
   
Sequence Name 06-K025300-022-537-D02C-RE16
GenBank Accession LN488647 [GenBank]
Sequencing primer gene specific primer, RE16: 5'-ACAGAATCCCTTTTCTTCCTTCTT-3'
Sequence (A. th genome BLAST matches underlined)
>06-K025300-022-537-D02C-RE16
ATCGTTCCAATTTGAACAAACCTGCTTCTCGCTTTCTTATGCTCAGTTTCAATCGCTGTG
CTACTTCCTCCAGCTTAGATATGATCACTGAAGCAGGTTTCTGTGATGTGAATCTAGATT
CTCTCTTGTTATCATCTCCAAACAGTCCTGCCAGATCAAACCCAGCAGACAAGGCAATTA
AATCAAAAGCGTTCAAATTTGTAGGTTCGTCTGTATGGTTTTCCTCCGTGACCCTGTCTC
CGTTTTCACTTGGACCTGCTCCATTCTCACTTGGACCTGCTCCGTTCTCATTTGTACCTG
CAGTACCAGCTTCCACAGAGTTTATCTCTTTGACTCGTTTCTCCATCTTTTTCTGTTTCA
TATGTAAACCTTTTCTGAACCAAGAACTCTCCCTGATTCTTGCGATGGTGATTCTAGTTT
CAGGGTTAGGGTCTAGCATCTTACACAACAGCCTCCGTACTTCTGGAGCAAACCAGCTTG
GTGCCTTAAAATCTGCTTTTCCTATCTTCCTGTACATCTCCATCAGATTGGAGTCATGGA
AAGGTAGATAGCCTGCCAATAGGACAAACAAAAATAAGGATATATTCAATTGTAAATGGC
TTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAA
GAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTAT
AAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAA
GCAATAAACAAATTATTCTAATTCGGAAAT

Last Updated on 23.10.2014 13:25