SimpleSearch - Line and FST details


Line specific information

 
Line ID 537D02
Vector Used pAC161
Line Availability only available from NASC (N451494)
Segregation Analysis 50:31:27
Confirmed for Hit At5g58380
Parent of DUPLO pair none
Parent of pair(s) 1766, 5269, 5298, 5301, 10345, 89881, 89884, 89885, 89886, 89887, 89888, 89889, 89890, 89891, 89892, 89893, 89894, 89896

Gene hit At5g58380

 
Sequence (A. th genome BLAST matches underlined)
>12-K020491-022-537-D02-8409
CCCGGNAATGTAGCCATTTACAATTGAATACATCCTTATTTTTGTTTGTCCTATTGGCAG
GCTATCTACCTTTCCATGACTCCAATCTGATGGAGATGTACAGGAAGATAGGAAAAGCAG
ATTTTAAGGCACCAAGCTGGTTTGCTCCAGAAGTACGGAGGCTGTTGTGTAAGATGCTAT
GGGATCCTCCCTATAGTGAG
GenBank Accession BX547086 [GenBank]
Graphic View Graphic view of gene At5g58380
Predicted Position of Insertion Chr5:23597930 - go to primer design
BLAST e Value 1e-73
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58380 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SOS3-interacting protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23