Sequences from confirmation amplicon


Confirmation sequences for line 537H06 and hit At4g25110 are shown.
Line ID 537H06
Locus At4g25110 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12889544
Primers used for PCR VL61 - 8474, show primer details
   
Sequence Name 25-K024451-022-537-H06C-8409
GenBank Accession LN497275 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K024451-022-537-H06C-8409
CATGTAGATGACGCAAACTGCATGAAGTTCATGTTGATGAAGCGTTTCCAATTCCCTGAA
TCTTGCATTCTTATGCTCACCGGTATTATTCTATATCATAAAATGTCATAATTTGTGTAA
CACGTAAAAGTAATGTTAAAAGTGTCAAAATGTTGTAGAAGAAGAAGCGGACCCAATGAG
ATGGCCAACGAAGAACAACATAACAATGGCGATGCATTGGCTTGTTCTTAGCTGCAAACC
GGGAGATTCCCTCGTCTTTCACTTCTCCGGTCACGGCAACAACCAGATGGACGACAACGG
CGACGAGGTTGACGGCTTCGATGAGACTCTTCTCCCGGTGGACCACAGGACTTCAGGTGT
CATCGTGGACGATGAGATCAATGCTACAATCGTACGGCCGCTCCCTTATGGAGTTAAGCT
CCATGCCATCGTCGACGCTTGTCATAGTGGTACCGTCATGGACTTACCTTATCTTTGTAG
AATGGACAGGT
   
Sequence Name 26-K024451-022-537-H06C-VL61
GenBank Accession LN497751 [GenBank]
Sequencing primer gene specific primer, VL61: 5'-ATTGAATTCGTACCTGTCCATTCT-3'
Sequence (A. th genome BLAST matches underlined)
>26-K024451-022-537-H06C-VL61
CAAAGATAAGGTAAGTCCATGACGGTACCACTATGACAAGCGTCGACGATGGCATGGAGC
TTAACTCCATAAGGGAGCGGCCGTACGATTGTAGCATTGATCTCATCGTCCACGATGACA
CCTGAAGTCCTGTGGTCCACCGGGAGAAGAGTCTCATCGAAGCCGTCAACCTCGTCGCCG
TTGTCGTCCATCTGGTTGTTGCCGTGACCGGAGAAGTGAAAGACGAGGGAATCTCCCGGT
TTGCAGCTAAGAACAAGCCAATGCATCGCCATTGTTATGTTGTTCTTCGTTGGCCATCTC
ATTGGGTCCGCTTCTTCTTCTACAACATTTTGACACTTTTAACATTACTTTTACGTGTTA
CACAAATTATGACATTTTATGATATAGAATAATACCGGTGAGCATAAGAATGCAAGATTC
AGGGAATTGGAAACGCTTCATCAACATGAACTTCATGCAGTTTGCGTCATCTACATGGAT
CAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTC
AATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAAC
GACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGG
AAATCTTTATTTCGACGTGTCTACATT

Last Updated on 07.07.2016 14:16