SimpleSearch - Line and FST details


Line specific information

 
Line ID 537H06
Vector Used pAC161
Line Availability only available from NASC (N451546)
Segregation Analysis 50:42:34
Confirmed for Hit At4g25110
Parent of DUPLO pair 2565
Parent of pair(s) none

Gene hit At4g25110

 
Sequence (A. th genome BLAST matches underlined)
>48-K020492-022-537-H06-8409
NAGCCATTTACATTGAATATATCCTGCAATGCACACCAATGTGCCTATGGGATCCTCCCT
ATAATGAGTCTATATCATAAAATGTCATAATTTGTGTAACACGTATAAGTAATGTTACAA
GTGTCATAATGTTGTAGAAGAAGAAGCGGACCCAATGAGATGGCCAACGAAGAACAACAT
AACAATGGCGATGCATTGGCTTGTTCTTAGCTGCAAACCGGGAGATTCCCTCGTCTTTCA
CTTCTCCGGTCACGGCAACAACCAGATGGACGACAACGGCGACGAGGTTGACGGCTTCGA
TGAGACTCTTCTCCCGGTGGACCACAGGACTTCAGGTGTCATCGTGGACGATGAGATCAA
TGCTACAATCGTACGGCCGCTCCCTTATGGAGTTAAGCTCCATGCCATCGTCGACGCTTG
TCATAGTGGTACCGTCATGGACTTACCTTATCTTTGTAGAATGGACAGGTACGAATTCAA
TAATTATTGACTTCTTGTTATGTACGTGTGTATGCACACCTCGAT
GenBank Accession BX547154 [GenBank]
Graphic View Graphic view of gene At4g25110
Predicted Position of Insertion Chr4:12889496 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13M23
Hit Gene Code At4g25110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation metacaspase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03