Sequences from confirmation amplicon


Confirmation sequences for line 540H06 and hit At5g04200 are shown.
Line ID 540H06
Locus At5g04200 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:1154347
Primers used for PCR VL60 - 8474, show primer details
   
Sequence Name 27-K024451-022-540-H06C-8409
GenBank Accession LN498214 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K024451-022-540-H06C-8409
CATATTGATCGATCCAATTGGTAATTGTTTATTTCTTTTTCTCCATATTTGTTGTATTTA
GACCACCACTATGGCAAGAATCAGAGATCATGGTAAAGCTTGTTCCTTTAGGAAGTTGAT
TGACCAATTCTCGGAAATCAACATCTGTGATGAGATTGAAATCACAAGGAACAATAGCTT
CGTCTTGTTTAAAAGGATGAGCAGATTTAACCGAAGGAATACGAGTTCCATGGCCACTGT
AGTGGAAGAACAAGATGTCTCCAGATCCGGCTTGAGCTTTATCCACCATCCTACGTAGAG
CAGCCTTGATGTTGGCACCTGTCGGCTTTACCTTTGATTCTGGCTCGTCCGTTAGCACCT
CAATGTCGTCTTGTTTGAATCCGAAACGTGACAAAATAGTTTCTTTCATGGCTAG
   
Sequence Name 28-K024451-022-540-H06C-VL60
GenBank Accession LN498681 [GenBank]
Sequencing primer gene specific primer, VL60: 5'-CAATGATGTTCTAGCCATGAAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>28-K024451-022-540-H06C-VL60
TATTTTGTCACGTTTCGGATTCAAACAAGACGACATTGAGGTGCTAACGGACGAGCCAGA
ATCAAAGGTAAAGCCGACAGGTGCCAACATCAAGGCTGCTCTACGTAGGATGGTGGATAA
AGCTCAAGCCGGATCTGGAGACATCTTGTTCTTCCACTACAGTGGCCATGGAACTCGTAT
TCCTTCGGTTAAATCTGCTCATCCTTTTAAACAAGACGAAGCTATTGTTCCTTGTGATTT
CAATCTCATCACAGATGTTGATTTCCGAGAATTGGTCAATCAACTTCCTAAAGGAACAAG
CTTTACCATGATCTCTGATTCTTGCCATAGTGGTGGTCTAAATACAACAAATATGGAGAA
AAAGAAATAAACAATTACCAATTGGATCGATCAATATGGATCAGCAATGAGTATGATGGT
CAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGT
CCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCG
TATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTG

Last Updated on 23.10.2014 13:25