SimpleSearch - Line and FST details


Line specific information

 
Line ID 540H06
Vector Used pAC161
Line Availability only available from NASC (N451834)
Segregation Analysis 50:32:23
Confirmed for Hit At5g04200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g04200

 
Sequence (A. th genome BLAST matches underlined)
>48-K020532-022-540-H06-8409
TTTCTTTTTCTCCATATTTGTTGTATTCAGACCACCACTATGGCAAGAATCAGAGATCAT
GGTAAAGCTTGTTCCTTTAGGAAGGTGATTGACCGATTCTCGGAAATCCTCGTCTGTGAT
GAGATTGAAATCACATGGAACAATAGCTTCGTCTTGTTTAGAAGGATGAGCACATTTAGC
CGAAGGAATACGAGTTCCATGGCCACTGTAGTGGAAGAACAAGATGTCTCCAGATCCGGC
TTGAGCTTTATCCACCATCCTACGTAAAGCAGCCTTGATGTTGGCACCTGTCGGCTTTAC
CTTTGATTCTGGCTCGTCCGTTAGCACCTCAATGTCGTCTTGTTTGAATCCGAAACGTGA
CAAAATAGTTTCTTTCATGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX547434 [GenBank]
Graphic View Graphic view of gene At5g04200
Predicted Position of Insertion Chr5:1154349 - go to primer design
BLAST e Value 1e-175
Hit Clone Code (BAC ID) F21E1
Hit Gene Code At5g04200 [TAIR] [MIPS] [SIGnAL]
Gene Annotation metacaspase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23