Sequences from confirmation amplicon


Confirmation sequences for line 578C07 and hit At4g34870 are shown.
Line ID 578C07
Locus At4g34870 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16614476
Primers used for PCR RP11 - 8474, show primer details
   
Sequence Name 35-K025675-022-578-C07C-8409
GenBank Accession LN501683 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K025675-022-578-C07C-8409
GTAGATTTCCCGGACATGAAGCCATTTACATGAGTCTCAGCGGTACTCCCATCGGACGGA
TCGAGATGGAGCTTTTCGCTGATACAACCCCAAACACGGCGGAGAATTTCCGTGCTCTCT
GTACCGGCGAGAAAGGAATGGGAAAGCTAGGTAAGCCACTTCACTTCAAAGGATCGATCT
TCCACCGTGTGATTCCCGGATTCATGTGTCAAGGAGGTGATTTCACCGCCAAGAACGGAA
CCGGTGGTGAATCGATCTACGGTGCTAAGTTCAAGGACGAGAACTTTATCAAGAAGCATA
CAGGAGCTGGGATTCTCTCAATGGCTAACTCTGGTCCTAACACTAACGGATCTCAGTTCT
TCATCTGTACCGATAAGACGTCGTGGTTAGATGGTAAGCACGTTGTGTTTGGACAAGTTG
TTAAAGGCTTGGACGTCGTGAAGGCGATTGAGAAAGTTGGATCTGATTCTGGAAAG
   
Sequence Name 36-K025675-022-578-C07C-RP11
GenBank Accession LN502078 [GenBank]
Sequencing primer gene specific primer, RP11: 5'-ACTTTGGAAGTCTTTCCAGAATCA-3'
Sequence (A. th genome BLAST matches underlined)
>36-K025675-022-578-C07C-RP11
CAACTTTCTCAATCGCCTTCACGACGTCCAAGCCTTTAACAACTTGTCCAAACACAACGT
GCTTACCATCTAACCACGACGTCTTATCGGTACAGATGAAGAACTGAGATCCGTTAGTGT
TAGGACCAGAGTTAGCCATTGAGAGAATCCCAGCTCCTGTATGCTTCTTGATAAAGTTCT
CGTCCTTGAACTTAGCACCGTAGATCGATTCACCACCGGTTCCGTTCTTGGCGGTGAAAT
CACCTCCTTGACACATGAATCCGGGAATCACACGGTGGAAGATCGATCCTTTGAAGTGAA
GTGGCTTACCTAGCTTTCCCATTCCTTTCTCGCCGGTACAGAGAGCACGGAAATTCTCCG
CCGTGTTTGGGGTTGTATCAGCGAAAAGCTCCATCTCGATCCGTCCGATGGGAGTACCGC
TGAGACTCATGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
TGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAG
ATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCC
GTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGA
CGTGTCTACATTCA

Last Updated on 23.10.2014 13:25